Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 511-540 from 3142 sequences on 18 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>1552 194 1444     4q22.1    chr4:92265417-92265224 BLAT!
GAACTGGTGTCAAGTGGGGGCCTTATTCTTCAGAGATGGTGCATTCTATGTGTTCTCACA
TGGAGGAAGGGGCAAACAAACTCTCTCAGATCCCTTTTATAAGGACACTAATCACATTCA
GCTGGCGAAGCCCTTAAGACTTAATCACCTTCTAAAGGCCCCACTTCTTAATACTATCAC
ATTAGGGATTAGGT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>23976 256 1444     2q14.3    chr2:127518409-127518664 BLAT!
TTCTACTCCAGCCTGTTTCCTGAGAACCCTGAAAAGCTGTTCATTTTGAATGGGGCATAA
AACAAGAAAGAACACTCTGCAATGGGTCCAGACTGCTATGAAAGTTCATCTGCCACTTGG
GCCACTGAATCCAGCATGAAGTGGCAGTGACAGGGACACTGTTCGGGGCCTGCAGCAGGC
TCCTATACGTGAATCATAGTCCAGGATTCCAGAGTAAAACTGAGCCGTCCTCTGCAGATA
ACTACTCTCCTTTTGA


invisible?    
Gene introns: 0  

>6202 270 1443     12q21.2    chr12:78118079-78117810 BLAT!
TATTCTCAGAAAAAAATACAGAAAAAGCATAATCAACTGATAGGTCTGTAAACAAATACA
TAAGTGCCCACATATACGGTCACAGCCAAAATTTTATATGAAAAATGCAATTTTTATAGA
AATTTGTAATAGAGAATGTGGTATTATTTAGTATTAGTAATATCTAACATGTCTTGATAC
TTTACATGTGCATCTAGAATATGTTATATACTTTATCTCATTTATTTACACAGTAAACTA
ATGAGATAAGAGTTATCCCCATTTAATGGA


invisible?    
Gene introns: 0  

>17150 195 1443     4q22.1    chr4:92265413-92265219 BLAT!
TGGTGTCAAGTGGGGGCCTTATTCTTCAGAGATGGTGCATTCTATGTGTTCTCACATGGA
GGAAGGGGCAAACAAACTCTCTCAGATCCCTTTTATAAGGACACTAATCACATTCAGCTG
GCGAAGCCCTTAAGACTTAATCACCTTCTAAAGGCCCCACTTCTTAATACTATCACATTA
GGGATTAGGTTTCAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>6991 172 1440     20q13.2    chr20:52382901-52383072 BLAT!
ATGGTGGATGGAGGAGGCATGAACTTCCCAGTTACTCAGCCTTGAGCTTCTTGTCTTAAG
TCTGCCTCCAAGACTTAACCAGCGGGCCGTATCATCTACCATGGCCAAGTAAGATTACTG
CAGACTGTGCTCTTCAAATCTGTAGCCTTTTGTTATTCTACACGGCCACTTT


invisible?    
Gene introns: 0  

>33121 226 1440     18q21.1    chr18:47021932-47022157 BLAT!
TATGTAGCACCAGCAGAATTTTCAAGAGCCTCAACATCTACTTTTAGAGACATACTATCT
GACGATGGCAAGTGTTTACTAAGAGCTTTGGCTTTCTCTGGATCTACAAGTGAGTAAGCA
GAAATAAGCTGTGCCAGGGTGTGAATATCTTTTGGATTTTGTTTCCACAGCTGTTGTAGG
TCACTAATTGCCTCCTTCTTCCGCCCATATTTGAGTTTGAAGTTTG


invisible?    
Gene introns: 0  

>14480 364 1438     9p22.3    chr9:15055615-15055272 BLAT!
TTGACTTCTGTAGCTGCAGGTCGTCCTCTTTTAGGACTCACTTTTAGATTAACAGATGCT
GTTGCTGTTGTCACTACTCCTGCCTCCTCAGTTTCTACTTGTTTTTCTGCCTTTCTCTTT
CTCCCCCTTCTGGCAGCTTTTGGAGTAGTTATGTCAACTGCTTTAGTCACATCCTCATTG
CTGGCTTTTTCTTCATGGTCGGTATCTTCCTTTGAAACACTAGTTTCCTTTTCTTCAACT
TCAACATCAGATGATGCATTTGATTGTTTAGTTGCTGCCTGTTGACTTGAAAATTTCACT
TTTGGATTGTTATCTATCTCCCATAAACCTTCATTAAAACCTTTTCTTTTATTTGGTTTG
CCAT


invisible?    
Gene introns: 0  

>16947 217 1438     4p14    chr4:38234067-38233852 BLAT!
GCAGAAAGAACAAAGGCACCGTGGCTGAATAGAATAGGATGTGAAACCTGGAGAGATATA
ATGGGAAACTTGGTAGGGGATACGTTGTGGGCAGCTTCCAGGGCCAGGCTGGTGAGTTTA
TTGTTGAACCCAAGAATGGCTGAAGACTTGATGAAATACATCACATCCATGTTGGCCACC
CATTTCACTGGGCCCGGAGTTTGAGGTTTGCTGAGAG


invisible?    
Gene introns: 0  

>1693 144 1436     Xq26.2    chrX:133407412-133407272 BLAT!
AAGTATTTAAAGGTTTTGCTTTTGGTCCCTCATATTTTCCTTTCTTCTCTAGAGGCTCTG
ACTCCTCAGGCCTCTGACTCCTCGTGCCTTCATCCCCTCTGAGTTCTTCCAGGATGAGGA
CTGTCTCCCAATTACTATAGTGAC


invisible?    
Gene introns: 0  

>22282 117 1429     4q12    chr4:58950443-58950386 BLAT!
GAGCCAGCATATCCAGAGATCACAGGGTAAGAGGAAAAGCAAGAGAGGTGGGAGGTACCT
CGGCCGCGACCACGCTAAAGATTGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAT


invisible?    
Gene introns: 0  

>26614 196 1429     5p13.2    chr5:34476195-34476390 BLAT!
AATCTATGCTCCCATTAACAGCAGTTACAAGAGGGTTTTTAAAGGAAGTGGGTTTTTAAA
GCAGTTCCTAAGTTGCTTACCAAGAACTTACATTAAAATAACGTAAGCTATTGATGGGCT
GTAGAATGTTCTTTGTGTCACAAATTTCAGAAACATAAAGATAATGGGTGAGGCAGCTCT
TTGCTAGTTTTCTTTT


invisible?    
Gene introns: 0  

>5573 211 1428     20q13.12    chr20:44307571-44307361 BLAT!
AGGAATTGGAGGTGGATATTTGATCTTCCCACTTGTCTAGGAATCTTAATGGTAAGTCCA
CTCCAGTTTCATCCCACTAGAGAACCAAGAGGGCTGAAAAACCTGGGGTGAATTGGGGAC
AAAGAGTAGGTCACTGATTGCAGCAACTGGCATGTGGATCTTGGTGATTGTTCAGTGCTT
TGATCAGTGGGGATGCCATATTGAAGAGACT


invisible?    
Gene introns: 0  

>8947 276 1424     2q22.1    chr2:142194606-142194331 BLAT!
TCATGCATCCATTTCCATTAATGGGAGTTAGCAACTGCTGCATATATCTCATAATTAAAT
TTACAGTGGTGCCAAGATGGGAAAGCCAGTGATGCAGCACAATATATTATTCTCATCCAA
AAGGTGCTTTTCATTGTCTGAAGAGACAGATGCCATGTTCTGTTAAGAACTATATGTGTA
GCTTTACTTACTAATGTAAATTATTCAATATGAAATGCTGCCAGTATAAATGGTTTACTT
CCCTCCCACCTCCTCTATTTTGAACCTAAACTGTTC


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>17718 221 1423     4q13.1    chr4:61309075-61309295 BLAT!
AGCCATGAAGGCTAGGTCCAAAGAAGTTGACCCAGTGTTAGAATTAGCCTTGAATCTGAA
TCTTCATGGTCATACCAGGCACTGGGATAAGCTAGGCATCTTAGTCCACTAAGATAGGCT
TGGAGCCTAAGTCCATATGGGCAGGCCTGGGGCTGGGGACTAGATCTATAGGGGTAGACC
TGGAGCCTTGGACTGTGAGGGCTGGCCTGGCACAAGAGTCC


invisible?    
Gene introns: 0  

>3510 194 1422     4q13.2    chr4:69365265-69365072 BLAT!
GAGTGTAGTTTCATTATAGCAACAGTTATTATTACTATGGTCTCTTGAACACCTACTAAT
GTTCCAAGAACTGTGCTAAGCACTTTTTAAACATTCACAGTTTTATTTCCACAACAATCA
TTTGAGCAAATATCATCTCTATCTTACGGGTGAGATTATAGGCTTAGATAAATAGTAACC
GGCTTAATTCACTC


invisible?    
Gene introns: 0  

>18158 230 1421     18q12.1    chr18:26232467-26232688 BLAT!
TTCAAGTGTCGTCAGATGTATCACGCACCCACAGACTGTGCCACAATCCGGAAATGGCTC
ACGAAGTGTGCAGACGACTCTGAAACAGCCAACTACATTAGTGCTCACACTAAAGACTGT
CCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAA
TGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGG


invisible?    
Gene introns: 0  

>17430 215 1407     16q21    chr16:63055680-63055894 BLAT!
TTAATTAAAACCTTATTTTAAGTTGAACCATTAATGAACATGGTATATCTCTCTGTATCT
TTGTTTTCTTTTATGTTCTTTAAGTAATTTCAAAAATTATGTCCATGTAAATCATGTATT
CACTGTAATATAAATTCCTAGCTAATGTTTTATATTTGTGAAGTCTTCATATACTTCTCT
CTTTTCCTTAATTGTTTATGGTTCCTTGGAGTTAT


invisible?    
Gene introns: 0  

>2217 117 1403     3p26.3    chr3:916760-916876 BLAT!
TTTTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTAGTCAGGATGGTCTCGACCTCCT
GACCTTGTGATCCACCTGCCTTGGCCTCACAAAGTGCTGGGATTACAGGCAGGGGCC


invisible?    
Gene introns: 0  

>25827 189 1403     6q13    chr6:72447639-72447827 BLAT!
CATGGAATAAGTAACCATATGTCCTTAACTGTTCATTATGAGCTAGATTCTACAGGGTTG
CATGGGTCTTGTAGCAATCTTTTATAGCACAGAAGTATTATATCTACTATTGGGCACAAA
CAAGGCAAGAGGCACAGAGTGTGAAGATCTTTGCATTATATATTAACAAACGCCAGAGAC
ACATTATCT


invisible?    
Gene introns: 0  

>5520 211 1398     9q33.1    chr9:120845701-120845544 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGCGCTCGCTCCGAGTTTCAGGCTCGTGCTAAG
CTAGCGCCGTCGTCGTCTCCCTTCAGTCGCCATCATGATTATCTACCGGGACCTCATCAG
CCACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTTGTGCCT
GGAGGTGGAGGGGAAGATGGTCAGTAGGACA


invisible?    
Gene introns: 0  

>12622 204 1397     Xq21.31    chrX:91726785-91726582 BLAT!
AGTCAAATAGTAAGAAATCCTGGTGAGGTTGTAGAGAAACAGGAAAACTTATCCACCGGT
GGTGAGAGCGTAAATTATTTCAGCCACTGTGGAAGACAGTGTGGCAATTACTCAAAGACC
TAAAGACAGAAATAACATTTGACCCAGCAATCCCATTACTGGGAATATATCCAAAGGAAT
ATAAATCATTCTATTATAAAGACA


invisible?    
Gene introns: PCDH11X (91090459 - 91878228)  

>20663 226 1394     5q22.3    chr5:114848029-114847806 BLAT!
CTGATGATCAACATCCATCATGCTTAAGATGGTGGCCCCATCATTAGTTACAGTCACATC
CCCATCCTTATCCACCATCATCTTATCAAGCCCATTTGGTCCAAGTGATGTTCTCATTGT
ATTTGCTACAGCCTTTGCTGCCATTATATGAGACTTGAGGGCCTCAAGTCCCATAAGACG
GGACTTGCGGTCCTGATCCTTGATGATGAGGAAAGGGCGCCCATAT


invisible?    
Gene introns: 0  

>24809 258 1392     20p12.2    chr20:12064148-12063891 BLAT!
AAATTCGGCAGTAGAGAAGTGTGATTTAGGACAGTAAGTGATGACATCATTAGTCTATGG
TTTAGAGCAGTGGTTTCCAAAGTCTAGTCCCCAGACCGTAATATCCACATCACCTAGGAA
CTTGTTAATGTGGACTTTCAGGCCCCATCCCAGCCCTACTAAATCAGAAACTCTGGGGTA
AGACACAGAAATCTATGTTTAACAAGCTCTCTAGGGTATCACAATGTGGGCCAGCATTTG
AGCACCACTGGTCTAGAT


invisible?    
Gene introns: 0  

>26145 324 1392     4q22.1    chr4:91432520-91432816 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGATTGCACCACTGCACTCCAACCTGGTGATAGA
GCAAGACTCCATCTCAAAAAAAGAAAGAAGATAAAAATCCTTGGTAACTTCAACACAGCT
TTACGTTGGTGAAGATTCAAGTGCTATTCGAATGAGTTCAGAGACAATAGACTAAAAGGA
GTTAGAGTTGGTGCATATAGGAAACCCTCAACCAGTTTTGTTGTAAAGTGGAATAGATAA
ATGAGGCAGTATCTTGAGAGATAATTCAGGTTCAGGAATTTTTCTAAAGATAGGTGATAT
AGAGCTCCTGTTTGGATGCTCTGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>19885 230 1390     18q22.3    chr18:68877386-68877615 BLAT!
GCAGAGGAGTAGTATAGAAAGAAAATAGCCTGTTGTGATACAATTTGAGCCAAAAAATCA
TCTCTCAGTAACCTGAAATTCCACTTCAGACTTTGTTTATGAGCCCTTAAGTTGAAACAG
ACCCAAAAATCCCATTGACTGTTCTTTTGGATAAACATAGAAATTGATCTTTCTGATCTT
AAAGCTTGAAGCCTACATTTGTTTTATGTGAGTGTCTTCCTCAGGAAAGG


invisible?    
Gene introns: 0  

>9530 249 1388     5q35.2    chr5:174666694-174666446 BLAT!
TTTAGGCAGAGAACAAAACAGAGGTATAAAAACACATTTTATTTCACATCCTGTCTCTCC
TCTTTCTTATTCCAAACTGATAGATACTATTGTTTTAATTCAAAAATATGTATTCAATGT
TTACAAAATGCAAGTCTCCATCTTAGGCAGAAACAGCAGTGAACAAAACAGGTAAGGTCT
TATCATTCACAGAGTTTTCATTCTGGAGAAAAAGACATCAACAAAACCAAACATCAATCG
ATAAGAAAA


invisible?    
Gene introns: 0  

>18100 198 1388     8p22    chr8:14985860-14985663 BLAT!
AATGCTGAGAATAAATGGGCCCCAAATCTCAAAGCTTATAAGGTGAGTCTTGGTTTTGGG
AACCCAGCATTTCCATTTAGAGTAACCAAGACATCACCGGGAGCTGAATTAACACATTGG
AGATATGTGGGAGAGCACTGAAAATAACTCTTCTTCCCACCAGTGGATGAAATTGATCCT
AGACTCTGGATCGTCAAT


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>15685 206 1387     2q36.3    chr2:227284143-227284348 BLAT!
TGAACTGGACAGAGAGAGAAGCTGAATTGAACTGTGATACAATTACAATCGAGGCCTCAG
CCAATTGAGGCAAGGAGGCCAGGCCTAGGAAAACTTCCATCATTCATTCTTTGGGTCTGA
GCTGCCTCTGGGGAGAAGAAGGGGCATAACCTTGGGCAAGGTGGTAGCCAGTAGCCAATA
CCCCCAGTAGCTTGGAGAATGAGTGA


invisible?    
Gene introns: 0  

>20850 223 1386     3q25.32    chr3:158601756-158601534 BLAT!
TGGCCAGGCTGGTCTTGAACTCTTGGACTCAAGGAATCCACCTGCCTCAGCCTTCCAAAT
TGCTAGGATTGCAGGTGTGAGTCACTGCACCTGTCCTACTGCTTTCATTTGATAGATGAG
AACATTAGATAGGGGAGTTGAGTTATTTGACCAACATCAAGTAGTTAGTAAGCAGCAGAG
CTAGGATCTGAATCCAAGTCTGCATGGATCTAAAGTCTGAATA


invisible?    
Gene introns: 0  

>1216 179 1384     10q22.3    chr10:81381136-81380958 BLAT!
TACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCC
TCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTAATGGGTATATACC
CAAAGGATTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCA


invisible?    
Gene introns: 0  

Shown 511-540 from 3142 sequences on 18 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs