Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 541-570 from 3142 sequences on 19 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>12164 198 1382     2p12    chr2:76155660-76155463 BLAT!
GGGGGATTGGGAATCTAAATTTTTCAAAGCCATAACTAAAGTAAATTGTCAAAGCATAAA
TAGGTGGTTTGAGACCTAGCTATTTCCTGGTATTTTCTCTGCGCTTAGAGGAGAGCAAAA
AAATAGCAATCTACTTCTTTTGACCTGTTTGCCCGTAAGTGGGTGTTTCTTCCCTAGCCA
GTCAAGGCAGCAGTTAAA


invisible?    
Gene introns: 0  

>4211 192 1381     1q31.3    chr1:194202679-194202870 BLAT!
AAAAAAAATGTGTCATTGGTTTATTAGTCAGGATGAATCAAATTATGCTGAATTAAAAAA
TTAGCCACGCTATCTCAACAGCTTAATACAACAAAGATTTGTTTGGGTCTGTATATGTTT
AGCACGTGTTAGGGTTGCAACTTGGAATGGTGGGCTCTGATCCACCTAGTCATTTTCATG
TCTGATATAGCC


invisible?    
Gene introns: 0  

>10404 128 1381     20p11.23    chr20:18485465-18485338 BLAT!
GTGCCGCGCTGTGGAAGCAGCTCGCGTGTAGAACCAGTTCTCATCGTAGGGAGCAAGCTC
TTTGTGCTTGGCCAGCTTGACGGTATCCACCCATTCGGGGACTTTCAGCTTCCCGGACTT
TTTGAGGA


invisible?    
Gene introns: 0  

>18275 304 1379     2q31.3    chr2:181782300-181781997 BLAT!
TGTCTGAAAGGATGAACATATTGCCATGTGAAAAGATAGTGGATCTATACGTCTGCTGAG
TGCTCTTGTTCTCACAGAGCAACTTCATATGCACAAGAAAAATAATTCAACATAAGTTCT
ATGCTTTTCTTTTTCCTGTAGCTCCCCTCAGCTGTTATCTTTCTTTAAAACTACAGTATA
TAAATGTCTTGCAATGAACAAAGTGATTTTTAACAGGTGTTTAATGCAATTTCATAAACC
TTTGTAAAACATCTAAAATTTGCCTGGATGGATGGTAGGTGCTGGAAGGGATACTAATGA
AATA


invisible?    
Gene introns: 0  

>19930 236 1377     2q32.3    chr2:194664709-194664944 BLAT!
CTAAATTCCAAAGAACTTTCCTTCCATTCAACTGAAGTAATCGTCATCTGTTATAGATAT
CCTTGAAATAATAGTTCAGACACTATTCAACCTCTAAATTATTAATGGAATCTTATACTT
TTTGACAAAAAAATACTTTTAATCCTTTCCTTTGAATACTTTCATTAAGCTTTTTCTCAT
ACCTGTATTTCTCTCCTAATCTTTATTCACCTCATCCTAATTTTCTGTTCTTAATT


invisible?    
Gene introns: 0  

>10132 194 1376     12q24.33    chr12:130467612-130467419 BLAT!
TGCGGTGAAAGCCTTCTACAAGAGAAGAGTTCATGATTTACAGAAACAGCTAAAGAAAAA
TAATCTAAGAATTTGTGATCCATATGGTTTGCAATTTGTTAATCTTGGTATTCATTGAGG
AAATGTAAGAAATTATTGTTTAGCTGTGGGTGCCTTTCTAGGTTTGGGGATTCAGCAGTG
AACTAGGCTGCCTC


invisible?    
Gene introns: 0  

>12283 286 1374     13q31.1    chr13:83465665-83465950 BLAT!
AAGCATCGTTTGTATATATTTTACATGGATGTATTAATCTGACATTTCTAGGATTTTGAC
TTTATAATCAGTTGTGATTAGAGTAGCAGCTGATAGAAATACACTGTGTCTAACCAGGCA
GGCTCCAGAGGATCCAAAGGCAGGAGGAGAACATGAGTGAGAAGAAGCTGGCATGTGAGT
CACAAGTTAACAAAAGAAACATGAATATAAATATTTCATGTGTCATATAATCAATTTTTA
TCTTCTTCCCAAAATAAAAATGTGTTTAAACTACATTAAACAATAC


invisible?    
Gene introns: 0  

>28292 209 1372     3p22.1    chr3:40972893-40973101 BLAT!
GTTCCCCCTAACCCCAGTTCCAGGAGGCTCAGATCAAAGACAGAGACTCTGTTTGTTTGG
GAGAGAGTAAGGAAAAAGAACAAGAGCCTCTGCCTGGTAACCCAGATAATTCTTCTGGAC
GTTATCCCACACCACCAAGGTGATACCTGTATAAGTCTGCAAGAACCACAGTGTTATTGG
GTTGGGGCTCAAGTTCCTTCAAACACCTG


invisible?    
Gene introns: 0  

>19166 235 1370     13q32.3    chr13:100236668-100236902 BLAT!
TGAAAGATGTGGCCACTGGATGGGATAAGAGTTTGCTGAGGTGCTGCAGACCATGGCTGG
CAAGCAGAAAACCACCTGCTGGGTGCTGGGGAAACTTTCCAGGAAGCCTCCTGTTGGGGT
GACAGTGAACCTTCCAGGAGGGTTCACATCTCTGGGTCTCCCACTGGCCCCACCAGCTGC
AGTATTGCAGGAGCAAGAGGAAAAACACTGGGACCAGGAAGAAAGCCTCTGCCAC


invisible?    
Gene introns: 0  

>28925 200 1370     Xp11.3    chrX:46278520-46278712 BLAT!
CATCAGCTGAAGACCCTCGCCCTTCAGGAAGCGCTCACGATTGGAACTAAGCATTAGACA
GGAGCAGAGGGAATCAAACAGATTCTCCATCATCTCCTGCTCCTCAGCCGTGCTGGGATT
GTGTCTTTTAAACACGGATAACTGCTGAAGAAGCACATCGATTCCATCCAGCTCCCCAAG
CAATTCCCTGTTTTCATCAT


invisible?    
Gene introns: 0  

>29425 141 1367     18q22.3    chr18:68877101-68876960 BLAT!
ATTAATAATCATGAAATTAATTACTAGGAGAGGGAAAAAAAACTGAAATAACCGTAATAA
TTGTGGTCCCTAGTGATTAAGGTAAGGTGTGCATAGGACTGAGGAAGGAAGATGGCTGCC
TTCTACCAGAAACCCTTCTTG


invisible?    
Gene introns: 0  

>20740 242 1365     13q12.3    chr13:29347251-29347492 BLAT!
CTCTGATGGTAGTTTGTATTTCTGTGGGATCAGTGGTGATAACCCCCTTATCAGTTTTTA
TTGTGTATATTTGATGATATCTCTTTTCTCTTTCATTAGTCTGGCTAGTAGTCTCTCTAT
TTTGTTAATCTTTTCAAAAAACCCACTCCCAGATTCATTGATTTTTTGAAGGGTTTTTAT
CTCCTTCAGTTTTGCTCTGATCTTAGTTATTGCTTGTCTTCTGCCAGCTTTTGAATTTGT
TT


invisible?    
Gene introns: 0  

>25285 277 1364     Xp11.21    chrX:55082053-55081854 BLAT!
TAGAGTAGAAGAAGATGGAAAAGGCAAAAGAAAGAATGAAAAAGCAGGCTCAAAACGGAA
AAAGTCATATACTTCAAAGAAATCCTCTAAACAGTCCCGGAAATCTCCAGGAGATGAAGA
TGACAAAGACTGCAAAGAAGAGGAAAACAAAAGCAGCTCTGAGGGTGGAGATGTGGGCAA
CGACACAAGAAACACAACTTCAGACTTGCAGAAAACCAGTGAAGGGACCTAACTACCATA
ATGAATGCTGCATATTAAGAGAAACCACAAGAAGGTT


invisible?    
Gene introns: 0  

>4616 207 1363     14q21.2    chr14:45228768-45228974 BLAT!
ATTATGAAAGACTGGAGTTTCCTAAGCTCAGAGTTCCTTAGCTGAGATGCACACTGTGAT
AGTTAATTTTATATATCAACTTGACTGGGATAATGGATGCCCAGATAGGTGGTAAAACAG
TATTTCTGGGTATATCTGTGAGGGTGTTTCAGGAAGATATTAGCATTTGAACTGGTAGAC
TGAGTGAAAAAGATCTGTCTCACCAAT


invisible?    
Gene introns: 0  

>5477 207 1361     11q13.4    chr11:71261248-71261042 BLAT!
GCTGGGAAGCCTGTGGACACTTGGATTCCTCCTCACTCTGAGCCCAGAGATGGAGGGTGC
ACTTCAGCCTGTGTTCAGCCACACCGTCTTGGATCCTTGAAGCAGCACAGTTTCCAGTGT
TGTCCTACAGAGCATCTCAGGGACACAGCTCATTCTAGTCTCGCTTCCCCCTCTCCTGGC
TTGACCCACAAACTGGGGACTGGCTGG


invisible?    
Gene introns: 0  

>5312 181 1354     3q26.31    chr3:175233008-175233188 BLAT!
GCTATAAATTAGAGCAAGAAAATTCTGTCACACAGAAATAGCTAGTATCAAACAGAGCCT
GTGGTTTCTGCTGGTAGAGGCCTCAACAAATAGTCTTGCTCATGACTCCTCTGCTTCTTG
CCATTTCTCTGCAATCATTGAGAGACTGCCATCCTGCCTTCAGAATACAGCCAAGAAAGG
C


invisible?    
Gene introns: NAALADL2 (174577110 - 175523428)  

>3435 120 1352     3p22.3    chr3:32266490-32266609 BLAT!
AGGAGTTCGAGACCAGCCTGGCCAACATAGTGAAACCCCGTCTTTACTAAAAATACAAAA
AAATTAGCCAGGTGTGGTGGTGGGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAG


invisible?    
Gene introns: 0  

>16869 199 1352     4q13.1    chr4:61454040-61453842 BLAT!
ACCCAAACGCTTTTTGAAATCCTCCTGCTATTTGAGCTTTCCTTGAGGGAGAACATAGGT
TCTCCCTCAAATCCCATTTTGTTCCTTTCTTAATTTGTGAAAGTGAGGCAGTCACATAGA
AAGATTCTGAGACAGGAATCCAGAGAGAACTAGGTTTAAATTTGGCTTGCTTCTTGCTCC
CTGCATAGCCTTGGGTGAG


invisible?    
Gene introns: 0  

>21751 265 1348     5q34    chr5:160608843-160608579 BLAT!
CATGCCATGCTCTCCTGGCATGTAAGATTTCCACTGAAAAGTCTTCTGCCAGACATATTA
GAGCTGCTTTGTAAGTTTTTTGTTTCTTTTATCTTGCTGTTTTTAGGATTCTTTCTTTAT
CCTTGATCTTTAGGAGTTTGATTATTACATGCCTTGAGGTAGTCTTCTTTGGATTAAACC
AGGTTGGTATTATATAATCCTCCTGCACATAAATATTGATATCTTTCTGTAGGTTTGGAA
AGTCCTCTGCTATTACCCCTTAGAA


invisible?    
Gene introns: 0  

>6209 214 1346     10q21.1    chr10:57830249-57830462 BLAT!
AAAGTTACCATTTACTGGTCAGTTAACACATGCTAGGGTCTATCTTAAATTGATTCTCAC
ACAATTCAGAGCAGTTAAAATATATAGAGGCAGAAAGATGAATGACTGTGTGAGAATATG
AAGAATTTCTCTCTGCCTGGAACAATTTCTTTCACAACACCTGCAATGTGATTACAACAC
ATTCTTCAAGTTTCAACTTAGAATTTACTGCTCC


invisible?    
Gene introns: 0  

>19792 285 1346     13q33.2    chr13:104881432-104881148 BLAT!
TGACAGAGACAACATCACTTTAAATGTCTTAAATCCAATTTCAAATTCTGTCCAAATTAG
GAGTTATCTCATGTGACCATGAAAATAGCATGTTTTGTAAGTGTAAATATGAATACTACC
TTATATATAGTGTTTTATATGCACAGAAAAGCTAGATGGGTTGAATACTTCTACCTTTGA
ATTTATAGTCCTTATGTTGTTCCTGTAAGTGACAAGTGGTAAATACAATTGATTCTAAAG
TCTCTCTTTCTGATATTTTTGAATTACAATTGGTCATTAAAAAGT


invisible?    
Gene introns: 0  

>29098 216 1343     Xp22.32    chrX:5224041-5224210 BLAT!
TGAAATTCAAAAGCATCAATATCATTCATGGTCAATCCTGCCTTTTCTAGAACTTTTGGA
GTAGCATATGTTGGTCCAAGTAATAGTTGATCTTTTGGATCCTGAGACACATACATAAAA
TCCCTCAAATATGCCTTCGGCTTATAACCCATGGCCAGAGCCTTTTCCTCCGCCATGATT
AACATTGCAGATGCACCATCAGTCAAGAAAGAAGAA


invisible?    
Gene introns: 0  

>24766 243 1340     2q24.3    chr2:168552441-168552199 BLAT!
TATACAACTGTCACTTCCCCTGCCTCCTTTCCCTCTGGTTGGAATGCAGACATGACGGTG
GGAGCAACGGTAGCCATCGTAGGTCATGAGATGAAAGCTGCTGGTTGAGAATAGGAAGAT
GTGAAGTTTCTAACACCATGGGCTGGTAGTATTAGCCCTAGAATCATTATGTGTTGATTA
TTATTTAAGAAAGAAATAGCTTCCCAACTTAAGTCACTGTCATTTCAGACTTTAATTTGG
ATT


invisible?    
Gene introns: 0  

>5084 174 1337     4q34.1    chr4:175445465-175445638 BLAT!
GAAGACCAAGGTTACATGGAAAGAGAAATGGACTGGATAATAGTTGAAAAGATTAGACAG
CAAACATGTTTTTCTTTTAAGAAAAGATAAGAAGATTGATTGAGGTCAAAGTGCAATGAG
TCAAGGATAGTGACAACTGGAAGAACAGGAAGCAGTTTGGCGGTGGCGGATAGG


invisible?    
Gene introns: 0  

>8258 223 1337     3p22.1    chr3:40972335-40972113 BLAT!
TGTTACCCAGGGTGCAATACAGAGTCCCCTTTACTTTTCCCACCTGATTTTCTCAAACAA
AAGGAGTCCTTCACCATAGCCACCACAGGTGTGAATGTTCTGGATCACACCTGAAGCCAG
TAAGTCTCAGAGCCCAAGGCCCACAGCATATTACCAATGTATTGTTCTTGGTTATTCAGG
GACCAGGGGCTCTTTAGTCAGCAGTTGGTGAATCCTACCAGGT


invisible?    
Gene introns: 0  

>11119 188 1337     Xq24    chrX:120140342-120140155 BLAT!
TAGGAAAAATACAGAAAAGAAGGCAGAATTGGAGAAATTGCAGAACAGAAGTTATATAAG
CAATATAGAAAACAAATAGCAAAATGACAGAAATGAGTCCTTCCATATCAATAATCACTT
TAAATGTAAATGAGTTAAACTCACCAATTAAAAGACACAGATTGGCAATGTGGATTAAGA
AAAATGAT


invisible?    
Gene introns: 0  

>21974 195 1337     7q35    chr7:145231550-145231744 BLAT!
GCTTGATTGAGACATGCAGTTAGTCATAGGGTAAGAGTCATTCCTCTGAGTTTAGCATCC
ATGGAAGCTTATGCTGGAATTGAGACATGATTCATTCTAGTATACACAAATAGATGTGGG
CTGAGACACATAACCCAGTGCCATTTTAAGGGGAGTCCCAATCCCATACTCCTGCTCTTA
CATGACAATTTATTA


invisible?    
Gene introns: 0  

>25735 249 1337     6p12.3    chr6:47112445-47112693 BLAT!
AAGATTTCTTGTTGTATTAATAGTTTTTCAACTTATTTCCTTTAATTTTCTTGATATAAC
ATTTATGTCTCTTATTTATACTTTAACCTAACTGTAATAGACTGTGCTTAGCCAATAATG
TCTCAAAATAGTGTCATGTGTGGGAAACTTTGTCTTTTAAAGCTTCTGGTGTTTTCACTG
TAAGCCTAATGCTGACTTTGAGCTTGAAATATCTTTTTATTGTTATTTGGTGAAGACAGT
ATCTATTAG


invisible?    
Gene introns: 0  

>32821 189 1336     4p14    chr4:38234714-38234902 BLAT!
AGTTCAAAGTCCAAGAAAAACATCACAGGGTTGGTTTGAAATCTAACTCTGTAGGAGACT
AGACTAGTCAGTTATTATTGTGATGATGCTGTGTAACAAACAACCTCAAAGTCCCAGTAG
CCTTCAATAACAAATGTGCACTGTTTGTTCATGTGTTCATCAGTGGCTATGGGTTAGGTG
CAGTGGCTC


invisible?    
Gene introns: 0  

>32582 264 1328     2q24.1    chr2:158236663-158236926 BLAT!
GGATGAGCTCTCACTTCCACTTAACAATTTCTCCCTGTGTTTTTCCAGTTCTTTCTTCCA
GTTCTCATTCATTTTTTCTTCAAATTCAGCCAAAGCCTTGGAGCCTTTCTTTTCCTTTTC
TAGTTGCTCTTTTACTTCTTCCCAGGTAGGCCTTGGTCGATTCAGATAATCCTGTATTGT
TGGCCCTGAAGACTGGATTGGACCCCTTGATCTCGCCATTGCTATTGGGTTCATATAGGC
CACCCGATTGTCCCGCTTCCCCAT


invisible?    
Gene introns: 0  

Shown 541-570 from 3142 sequences on 19 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs