Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 571-600 from 3142 sequences on 20 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>28687 207 1326     15q14    chr15:39008645-39008851 BLAT!
AGGTGAGGCTTCATTCTTGAGGTCAGCAAGACCACGAACCCACTGGAAGGAACGAACTCC
GGACACATTAGCATGTTCCTTTCTTGTATAGAACATTATTTTGTCATTTTTGATTCACTT
GACAAATATTTACTAAACATGTGCCTGATCCTTTATTAAGTAGTGAGGAAATATGGTGAG
CAAGACAGACCCAGGTCCCTGCCCCTC


invisible?    
Gene introns: 0  

>10149 198 1325     3p14.1    chr3:67965993-67965796 BLAT!
CCTTTCAAGTCACAAGAACAATCTCATTTCAGTAACTACAAAGTCCACTTTAAAGTATAT
TACGACTCTAAATTTTAAATTGTTCTCCTTTCCTAGTTCAAATTCACCTCAAGAGGGGAA
GTTTTCAGTGAGGGCAGGAGGTGTGGTTGCTTCTTTTTTTGCCCTGTCCCATCCGTCCAC
ACTGTGATGGTTAATATT


invisible?    
Gene introns: 0  

>7700 266 1322     Yq11.221    chrY:15344038-15343773 BLAT!
AAGAGGTTTCAGACAAAAGTTGGTGGTATTCATCATCACTGAAATTACCTTACAAGGAAT
GCTAAAGGGAATTAGGTTGAAACCAATGAAGCTAAACAGCAACACTGAAACAACTCCTTG
ATAAAGGTAAATATATAGGCATATATAATAATGTTCTAACATAAATCATAATAATGAACG
AACACCATATAAAAATGTAAAATGTAATAAAAGCAGAGGAAAGGTAAAAGTGTTGATGCA
ATTATAGTTCAGTTATCAGCTTAAGA


invisible?    
Gene introns: 0  

>9447 250 1322     4q22.3    chr4:96565587-96565338 BLAT!
TTGTCTCAATATTACCAGATCCAAAACCAAACTTCCCATTTACCCCCACCAACCCTGTAT
CTCTCATATTTTTGTCCAGCTCAGCAAATGTCAACTTCATGGTTCCATTTTTTTCTAGAC
AAAATCTTTGGAGTCATCTTTGACTCTCTCTCTTTCTCATACATTGTGTCCAATCCACCA
ACAAAACCTATAGGCTATAGATTTTTAACATAATCATCTTACTACCTTTACTCTTCTTAA
AATAACCATC


invisible?    
Gene introns: 0  

>15497 215 1321     8p12    chr8:35047398-35047184 BLAT!
CCCAAATAAGTGTCACTTCTATGACAAATTTTCATAACACAAGATCTGCCCTTACTCATA
TTGACTTATTAGTGCACAGAAAAGTTTTCAAAAAACATCAGCCTTTGGTTCTTAAGGGAA
ACTTTAAAGAAAACCTTATAATAGATGCTTTACAAGTAATAGACACATAAGCACACAAAA
AAAGACAAGCTACTGATTCCTGGCTGTTTTGATTT


invisible?    
Gene introns: 0  

>8807 187 1318     2p22.2    chr2:37069646-37069832 BLAT!
TTCATGTAAGGTGAATGGCTAAATCACCAAGGACAAGATACTTTTCTATGAAATAGGTCC
TTCCTATCAGTAGGTTATTGCAGACTTTGCTCACCCAAATAATGACTTCCAATCTAACTG
AAACTACCATTACCTTTAGTGAAATATCAATTAGGAATAAGGAAAGGGTTAGGTTTTGTA
GGGTTTG


invisible?    
Gene introns: 0  

>26154 275 1312     13q31.2    chr13:87869311-87869585 BLAT!
TAAAGAGATAAATCCTCAGTAAGAAGCAGGGTTGAAAATAAAGAAGAGAGAACTGTGATT
AATAATTTAAACAGTTGAAGCAAATGGAAAGTAAAATGTAAATCACAGCTGAGAAATTGC
CTCCAATCAGGAATAAAAAGCATTTTTAATAGGATGGGAGAGGTAGAGCATGGGAACAGA
TTGTGGTGTGTTTGAAGGATTTAATGGAAAGATGAGGTGTTTCAAATACTTCTATACTTT
CTGAAATAGAAAATAACATCTACTGACATTGAGAG


invisible?    
Gene introns: 0  

>305 171 1309     2q31.3    chr2:181816769-181816600 BLAT!
TATGTTTTAAACCCTTGACACTTACCTAAAAGAAAAGACAGCCAAGAAAATCATCAGGAC
ATAAATTCCCCCTGGACAAAATCAGTTTTATGGCACAATATGACAAAGACTTTTTTAAAA
TTTTTGATTTTTCAAAGAAAGAAACAAAGAAATGAAAATCATGGCAAAGAA


invisible?    
Gene introns: 0  

>10040 215 1306     6q12    chr6:64958149-64958363 BLAT!
GGAGGCTTGTCAGCCATCATTTAAGGCAAAGTGAAGTCATCAATGTCTCTTAAGCAGGAA
ATTAGTAATTCATGTTTATTTTCGAAACTACACTCTGGTTTTAGCATGGAGGATGGCTTG
GAAAGGAGCTGGAGGCAGTTGAAGGAGGAGGAGAATTGGACTGATACTTGAACTAAGAGA
ATGTTATGGGAATGTAAAAAAGTAAAGAGATTTAG


invisible?    
Gene introns: EYS (64429875 - 66417118)  

>31252 234 1306     9p22.3    chr9:15151038-15151271 BLAT!
AAGTGTTGTGGGACGGGCATTTCCAATACCAAGGAAGGTGCCAGGAGTCACCAAACCACC
CACAAATCTTAAGGGGATTGCCGTGGCCTCTTAGTCACCCAGCCGGAAGCTGCTATCTTC
CTGGCAGGAATTGCCTCCCCCTCTACCCCTGCTATTGTGCCAGATGTTCAGGTTGCCTGA
ATACGTCTGCCCTGGTGGATTACTTCAGGCACCCCTGCCCAAGAACATTCATGG


invisible?    
Gene introns: 0  

>26340 222 1305     7q31.1    chr7:108264497-108264276 BLAT!
ATTCCTTCTACCACATCTTATTAATGATGTGGACATTTGAAACATTAAATTCCACAACGA
TTTAATTGGCACCTGCAGCCCTGAATTACCCTTCTGGAAAGATCATGTCAGTCCCCACTG
AATGCTTGTTCTGAATTGCCAAATAGCACTTAGAACTGTGGGACAATGGTCTGCTGCCCT
CCACTAAGTCATGTCATGCTTTATTCTTCATGTTGCCCCATG


invisible?    
Gene introns: 0  

>9483 205 1304     8q23.3    chr8:117475684-117475480 BLAT!
AGTGCTCAGCAGAAAAACCCACAGTGGAGGGAGGTGAGCAGAATAGGAAAGGGAGAAGAG
CTGAGCAAACAAGGATGTGGCCTCAGTGTAAGTGCACCTGATCCATAGCAGAAGGCGCCA
GCACATAGAGACCAGGGCACAGTCTCTTGTTTTTGAAACAAGAGGGCTGATGGGCTGTGG
GGGATGGGGCAGGGAGTGGATGGGG


invisible?    
Gene introns: 0  

>16561 148 1304     6p12.3    chr6:47115633-47115486 BLAT!
CCTAGTTTTTAAGGGCAAGCAGAGGCAGCTGTATGATTAAGTCCACTAAATAATTCAGCT
TGCTTTTTAACATCAGCCTAAATCCCCACTTCCATTCTTCAGGTAATCATAGCAGTATAA
TTCACAAATAGTGCATTGTTATACCAGC


invisible?    
Gene introns: 0  

>17158 223 1304     3q28    chr3:191338981-191339203 BLAT!
AAAACCCATAGGAACCAGAACTCGGCTGTTCTAGTTCCTATGGGGTTTATACTTTTTGAG
TGCAGAGAGTGCACCTTTCTTTAATAATAAATGATTATAAATAAAATGGGAAGAAGACAT
TGAGGCATTTCATAGAACAGAAAATAAATGACCAATTAAAAAAGGAAATATACTTAACCT
TATTGGTGAATAAGGAAATACAAAGTAAAACCTCAATAAGAAA


invisible?    
Gene introns: 0  

>18792 149 1304     Xp22.13    chrX:17533044-17533192 BLAT!
CTGGCAGCTTTATGTGGGTAGAATCAGGGTCGGTATGAGTGATCACTGACTCCTTGAAAG
ATGCCTTCCCCAGAATCCAAGAGTTGAACTATAAATCAGGTCAGCTTAGGTCATCCTAGA
GATGAGGGGCCCTTGCAGATTTGGAGCAA


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>28713 265 1304     18q11.1    chr18:18899269-18899005 BLAT!
ATGTGCAGGATTGGGCTTCGTCAATTTGGTTAACCTAGGAAATATGTTTCCCCTTCTCTG
TATGATTTTGAATTAGACTTTGTAGGTATGGAAGAGGTTGGCGTGAGATTTGGAACTGGA
AGTGAAGAAACAGCCATTACCCTTAGAATATTGCTTCAGTTAAAAACTGACAAATGGTCA
CTGGTGCCAGAATGGATATCTGCTTGTTCTTGCTCTCCTCTCTTCCACATCTAGGTTTTC
TTCCTGACTGTTGGCCAAGAGGGAC


invisible?    
Gene introns: GREB1L (18822202 - 19102791)  

>9803 202 1300     20p12.2    chr20:11925574-11925775 BLAT!
ATTTCCAACATATTCTATTGGCCAAAGCAAGTCGTGAGGGCATCCCAGATTCAAGAGGTG
GAAAAATAGACCCTGCTTCATGGTGAGAGGAACCACAAGTTCACATGGCAAAGGACATGG
TTTCAGGGAGGGGTGGAATGTTGGAGCCATTTTTGCAATTAGTTTATCAGAGTCAGAGTG
AAATGCATAGACCAGGACTAAC


invisible?    
Gene introns: 0  

>1942 152 1294     1q31.3    chr1:194202678-194202829 BLAT!
AAAAAAAAATGTGTCATTGGTTTATTAGTCAGGATGAATCAAATTATGCTGAATTAAAAA
ATTAGCCACGCTATCTCAACAGCTTAATACAACAAAGATTTGTTTGGGTCTGTATATGTT
TAGCACGTGTTAGGGTTGCAACTTGGAATGGT


invisible?    
Gene introns: 0  

>28165 261 1291     7q31.31    chr7:117614967-117615227 BLAT!
ATTAATTACTGAAATTTTCATTCCAGAAAATGTGTATATTTTTAGAGCATTTAGTGTATG
AGACAAAAAGGCCTTTGTGACATATTACCCTCTATTTTCTGTCTGTTGGTGTCTCTTAAA
AGGAATTTCCTGGCATTTACCACAGAATGATAGCTTAAATTCAATTTAATACTCATCTTT
GTCCTTAATATTCCCTTGGGTCATTTCTCAAATGAGAGATTTAGTTAACTGAGTTGACAC
GAGAAATTAGGAGTAATTTTA


invisible?    
Gene introns: 0  

>16509 323 1289     9p22.3    chr9:14921748-14922070 BLAT!
ATCTCCATGTTCCCCAAGGACCCACCCATGACAGCTTAATGGGTGAACTCCCAGCCTTTC
CCCCATTAGGTAACGGAATCGGGCTGAATCCAGATTGCAACCGCTTCCAATAACACGGTT
TTTGGGAAAACCACTTATCTTCCAAGCCACGTAGGTCAAGATATCCACTGGATTTGAAAC
AATAAGCAACTTGCAGTTCGGGCTGTATTTTACAACATTAGGAATGATGAATTTAAAGAT
GTTCACGTTACGCTGGACCAAATTAAGACGGCTTTCTCCCTCTTGCTGACGTGCCCCAGC
CGTGATAATGACCAGCTTGGAGT


invisible?    
Gene introns: 0  

>11247 241 1287     6q13    chr6:72447306-72447066 BLAT!
TGTGAGTAATATGCCCCCTCCAGAACTTGAGAATCCAAGGAAGCTTCTAGGGCATTATGC
TACCTTCTTAGCTGTGAGAAGTGAGAGATGTAGTATGATCCTATATTTGTATTAATCTGT
TCTAGCAAATTTGTATTTGGTATATCTAATTTGTTTCATCTGTTCTAGCAAAGCTATCAT
ATCTAGCACAGCAGGTATAAATGATACTATTTGTTTGGCTAAGTTTGTAGTATTCCACTG
C


invisible?    
Gene introns: 0  

>32258 218 1287     21q21.3    chr21:29400506-29400723 BLAT!
GCAGGTTGATTATATTGGATCTCTTCCCTCATGGGAAGAGCAGAGGTTTGTCCTCACTGG
AATAGACACTTATTCCAGTTATAGGTTTGCTTATCCTGCACCCAATGCTTCTGCCAAAAC
TACCATCCTTGGACTCACAGAATGCCTTATCCACCGTTATGGTGTTCCACACAGCATTGC
CTCTGACCAAGGCACTCACTTGCGACAGTGGGCACATG


invisible?    
Gene introns: 0  

>30243 202 1286     16q23.3    chr16:81754683-81754482 BLAT!
TTGAGCTCTTCTCCTGCACATCCAGGAGTGAAGTTGCAGGGTCCTAGGGTAGGCATATGT
TTAACTTTAGTAGGTTGGCTCTCCAAAGTGGTTGAACCCATCTATCCTCCCTTAGTGATG
CATGAGAGTTTCTTTCAGCAACCACCCCCATCTCTGAAAACAATGCAAACTGGTTCTCAG
GCTCCCAATGGCAGACACCTAC


invisible?    
Gene introns: 0  

>17100 262 1282     1p31.1    chr1:73044627-73044888 BLAT!
ATAAATAACTGTTAAATCTCTGTTAAAATTTTCTTCTTTTTAAAATTCTATTACTTATAT
GAAATTCAAACTACCACTAGTTGAGATAATTTCAGGCTGTTGTGTCTTCCCCCAAAAAAC
ATTGCTGTTCAGAATACAGTAATTGAGAGGGTGTCCTTTGATAAGAAAATATTTTAAGGA
TGTAAAATAACTCTGTTTTTATAAGCAATAATTTCGGTAAAATATTATCTTCGTATTTGG
GCACGTTGAAGAATGTTTATTT


invisible?    
Gene introns: 0  

>4762 200 1276     11p15.4    chr11:3256786-3256587 BLAT!
CCCTTTAGAACCAGAAGTAGAAGTCGTCATCCTCTTTCTTGAAGCTCCAATCCTGTCACA
TGCCACAGTGCTCCTGGTCCCCATGAATGTTATGATGATCAAGTCCAATAGGCAAATGGT
CCCCCAAGGCACTGACTTCAACATAACCCATCACAAGTGCTTGTTTGATTGATGATGAGC
CACAGAGTGGCATGGATCAC


invisible?    
Gene introns: 0  

>9524 216 1275     5q21.3    chr5:105751513-105751348 BLAT!
TGAAGTTCCTATTTGTCACAATTTTTTACTTCTCCATTGTAGGCTGCAACCCCACCCTAT
GGATGAACAGGATCAGCTGCTGCTCTCTGAAAAGCCACAGTTGTGTCAGCTATGCCAGGA
AGACGGCAGCCTAACAAAGAATGTGTGTAAGAACTGCAGCGGAACCTTCTGTGATGCCTG
TTCAACAAATGAACTGCCTCTTCCTTCAAGTATCAA


invisible?    
Gene introns: 0  

>16478 214 1274     1p22.2    chr1:89469958-89470171 BLAT!
TTATCCCTTCACTTCTTGTATCATTTTTTTGGATTTCCTTGCATTGGGCTTCACCTTTCT
CTGGTCCTTCCCTGATTAGCTTAGTAACTAACCTCCTGAATTCTTTTTCAGATAAATCGG
GATTTCTTCTTGGTTTGGATCCATTGCTGGTGAACCAGGATGATTTTTGGGGGGTGTTGA
AGGGCCTTGTTTTGTCATATAACCAGAGTTGGTT


invisible?    
Gene introns: 0  

>23424 233 1272     12q21.2    chr12:79187710-79187490 BLAT!
GAGCGGCCGCCCGGGCAGGAGGACTACGCTGCAATTAGAGACAACTACTTCCGAAGTGGG
GAGGGGTTCCTCTGTGTTTTCTCTATTACAGAAATGGAATCCTTTGCAGCTACAGCTGAC
TTCAGGGAGCAGATTTTAAGAGTAAAAGAAGATGAGAATGTTCCATTTCTACTGGTTGGT
AACAAATCAGATTTAGAAGATAAAAGACAGGTTTCTGTAGAAGAGGCAAAAAA


invisible?    
Gene introns: 0  

>4566 138 1271     Xp11.3    chrX:46299824-46299699 BLAT!
AGGTACGCGGGGGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCC
TCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTC
AAGATCATCAGCAATGCC


invisible?    
Gene introns: 0  

>20274 226 1266     17q22    chr17:50304020-50303795 BLAT!
AAGATTAATAAAAAACTACAGAAGTGCTTTATAAATGAGCAATTGGAAGAATCTTTGCTA
AGAATTGCAAAAGATTCCATTTTGATGCTGTTTATGACAGTTTGGACTTGCAAATGACAG
AACTAGACTCCGGTAAGTTTAGGCAAAAGGAGATTTTGTGGTTCATACACACATAGAAAG
GTCAAGGATAAGAAGGCAGTCAAGAAAAAGGGAAGGACAATCGCTT


invisible?    
Gene introns: 0  

Shown 571-600 from 3142 sequences on 20 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs