Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 601-630 from 3142 sequences on 21 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>8352 172 1264     13q31.1    chr13:82485295-82485466 BLAT!
AAAAAAGAGGACCTGAGGTGTATGGTGACTGTAGAAGCTCTTGTTCCAAGATGAGCCTTA
ACAAACATCGCCCACTTTTCACATCCTTTTGTGATCTCTCCCTACATTGCAATAGATCTG
AGCCTGAGGCTCACTTTAAGTCATAGAATGGCAGACCTAAGAGTGCCAACTT


invisible?    
Gene introns: 0  

>20097 213 1264     2p16.3    chr2:47901404-47901619 BLAT!
AGGGACATAATTTCTCGTTGGTTTATGCCATCACTGTTTGCTGTGTTGTTGTTGTTGTTA
CTCTCATCTGAACTATTGTTGAACATCATCTGAACTGATATGGGGAGTGGTTGCCTAACA
GATAACCAACAGTGTCTGCTGTTAAGAGCTTCTTGGAGGCCAGGCATGACGGCTCATCCC
TGTAATCCCAACTCTCTGGGAGGCTGAGGTAGG


invisible?    
Gene introns: 0  

>30979 216 1263     12q24.21    chr12:116146096-116146311 BLAT!
AATAACAGAAAACAGCCATTTCTACCGAGAGGAGCCGGAAGCCAGCTGAGCATGATGACT
TCAGACTCTGCCATTGACACTGAACTATAGTTATGTGGCGAGAGCATGAGACGGAGGCTT
GATTTCACATTTTCTTAGAGGTGCCCTGTGCTGAGTATCTGACATACATTATCTCATTTC
CACCTCACGACAACCCCATGAGACAGATGTAAGCAT


invisible?    
Gene introns: 0  

>26001 186 1260     5p15.32    chr5:5917301-5917116 BLAT!
TGTTTAAACAGCATACGGAACTATCTAAGTAGGAAGGATTATTTTCCTAATAGGGCCAGA
CTTACAGGATCACAGAATCTAAGTATTGAATGAAAGCCAGAGTTATTGCAAGGAAAATAC
CTCTCAATTCAAGAATCTATTCTACAGAATCATTGATTCATCCATCCATCTAGCCACCTA
TGCATC


invisible?    
Gene introns: 0  

>15146 192 1257     3p14.3    chr3:55240076-55239885 BLAT!
GTAGAGAGAAATGGCCACAAATTTGAAGATGTTGTCTATCTCTAGAGCTGGTGTTATTCA
GTCATGTTGGGCAGATTCTGTTTTCTGAAGGGTGAAGAATAATGGAGATGGGATTATTCT
TGAATGCTGCTGATTCTTTGGAGTTTGCTGAGTTGCTTTAGGAAATAAGAAATGAATCGG
AGGCCCAGGTAG


invisible?    
Gene introns: 0  

>19002 234 1256     2q31.3    chr2:181644058-181643825 BLAT!
TTCAGACTGTTTCCTGGAAGCCGTTCGCCATTATCTTAGTGATTTAAGCTTCTCAGGACC
TATGACTTCTAAATTTTTCTATTGTGTGATTCAGAGTTACATTTATATTTGCTTTACTTC
CAAGTGTTTAAATATCTGGATGTAGTCACAAGTAAGTTGGATGATAATAACAGGTTGCAG
TTTTTAAGAACTTACTATTTTTAGACACTGTGCTAAATGCTTTCTACGTATTAT


invisible?    
Gene introns: 0  

>13521 210 1255     4q13.2    chr4:67987217-67987426 BLAT!
CTTTCTCTAAAGTTAAGGCTTAAACTCATATGAACATGTTTTATTTAAGGACCTCAAAGC
ATTATACCCACAATTAATTATTCGACCATTTCCTATTATCAGTCGAAGACCGGAAGCCTT
GAGAGTCAGGTTCAGCAGGAGCCTTCAAGTCCTATTATGCAGAAATAGAGGGTAAGTTAC
TGACTTGAGTGCCACAAGCATCAATAAGAG


invisible?    
Gene introns: 0  

>10303 219 1254     Yq11.222    chrY:19968627-19968845 BLAT!
CCACTGGAAGGTGGAATGCCTGCAGAGACATATTTTGCATTACAGGGCCCGATTTTAGAT
AATCAAGTAAGACTTATGCATCCCAGGGCTCAATTCAGGCTTCAATTGTAGTCTCACCAA
TTCACCACATGTAGCAAATTCTCACTGTGTGACATCACAAAGAGTTATTTATCTGGGGTC
CAAAAACTTGAGGAACGTGCACACAAAGTGAAGTTAGCA


invisible?    
Gene introns: 0  

>18482 239 1252     4q32.1    chr4:156487288-156487526 BLAT!
ATTATGTCCTTATTAAAAACTCAAAGAATATATGTTTCTGAGTAAAGAATAGACAATGAA
AACAAAGTTCACTAATGCCAGAATATTGAGGAAGACAGCCCCTGGAGGAGGGAGGAGACT
TTGTAATATAACTATAATTTTCCTAAATTAGGTGGTGCAAGTATGAAGGAATAATATTTC
AAATTATGGCTTTTGGAGACTCTCTAGTTTCAGGGTGGGAAGACACCAAGTGCAGTCTT


invisible?    
Gene introns: 0  

>23629 194 1251     12q15    chr12:68212752-68212945 BLAT!
GATTTCTGCAGCTTGCCTGACTCCTGGGCCATTTGTGTGTGTTTTGTTCCATGATGAAAG
GCCACCACTTCTGCAGGACAGCCATATCATACAGGTCAGAGGAAACGAGATGATGTAGGT
CTCAGGCTGCCCTTTTGGGTTCAAGCTTCTACTGTGGGTTCCAGTCTATCCTTGCTCTCC
TAACTTTCCATCCA


invisible?    
Gene introns: 0  

>29313 203 1251     2p16.1    chr2:60962217-60962015 BLAT!
ATATTATGGGAAAAAACTGCATGTTGGGTATCTACAGCCATTGGTTGCTGTTCAGGTCAG
CTTTGCTCCTAACAACACTGGGAAAGAAGTAACAGTTGAGTGCAAGATTGATGGATCAGC
CAACCTAAAAAGTCAGGATGATCGTGACAAGTTTTTGGGACGAGTTATGTTCAAAATCAC
AGCACGTGCATAGTATGAGTAGG


invisible?    
Gene introns: 0  

>29545 207 1249     21q21.3    chr21:29133753-29133547 BLAT!
TTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTGTCTTTCTTTAAACTGATGT
CTTAGAGGGGAAATGTTTAAATATCTCTTGAGTGCCTTCACCTAGATTGTAAATATGTAT
AATTTGTAGAATTAAATCTCAGTAATTTGTAAACTCTAAATACTTACACACTAAAGGAAT
GGATTTAATAATTTATTTTATGAAAAA


invisible?    
Gene introns: 0  

>21166 121 1245     2q31.3    chr2:181708083-181708203 BLAT!
AGGTACATGCCACCATGCCTAGCTAAGTTTTGTATTTTTAGCAGAGACAGGGTTTCACCA
TGTTGGCCAGGCTGGCCTCGAACTCCTGACCTTAGGTGATCCACCCTCCTAGGTCTCTCA
A


invisible?    
Gene introns: 0  

>25912 311 1241     2q12.1    chr2:104413712-104414022 BLAT!
TGAATATGGAATATAAATATGCTAAATTGATTATGTCATGAATAGACTTCTTTTTTGCAT
AACAATGTTTGGAGTTTCTCACCTTTCTCCTCGCCTTCTTTTTCTTCCTTAAATGTAGCC
TGGAGGTTTCCTATCTATTCCATATAACTAAGAGTAATCGTTTATTTAGGAAAGGGTCTC
ATGTGGTCTAAGATTAGCAATGGCAGATGTGAAGAAAATGAAGAAGAATGGAAGGGAATA
TAGATGCACTTCCTCACGCTTTCCAAGACCCTGCAGTGGGGAAGGTCCAAGTAACCAGTT
CTGTGACGTGT


invisible?    
Gene introns: 0  

>528 168 1239     11q22.1    chr11:101903288-101903121 BLAT!
AGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGC
ATTAGCAAAAACTTCATGAATAAAACACCAAAAGCAATGGCAACAAAAGCCAAAATTGAC
AAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGGAAAAGAAACT


invisible?    
Gene introns: 0  

>364 154 1237     6q22.32    chr6:126850367-126850482 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGCAGGGCGTGATGGCTCATGCCTGTAATCCCAG
CACTTTAGGAGGCCGAGATAGGTGAATTGCTTGAGGCCAGGAGTTCGAGATCAGTCTGGC
CAACATGGCAAAACCCCATCTCTACTAAAAATAC


invisible?    
Gene introns: 0  

>33286 212 1237     5q33.2    chr5:154373995-154373786 BLAT!
TTTGGGCTGCGAAGCCATGTAGAGGGCGATCAGGCAGTAGATGGTCCCTCCCACAGTCAG
CGCCATGGTGGTCCGGTAAAGCATTTGGTCAGGCAGGCCTCGTTTCAGGTAGACGGGCAC
ACCATCAGCTTTCTGGAAAAACTTTTGTAGCTCTGGAACTTTGTTTTTCCCAGCATAATC
ATACACTGTGGAATCGGAGGTCAGTTTAGTTG


invisible?    
Gene introns: 0  

>276 238 1235     2q14.3    chr2:127519214-127518977 BLAT!
AGAATGGGGCAAACTCCCAGAAGCACAAGCATTTCAGTTTTTCTGTAGTAATCTGTCATT
AATGGGGCCTGCAAATTCCCGTGTCCACACATGTGAGCAAGAAAAATGGAATGTGCCCCC
TAAGCATGAACTCGGCCCACTATGCCCTTGGCTTCTGTGCAGCTGTCCATGCCCAGAGCC
TCCATGACAGCGGCCTAGTCATTCCTCTCCAGGAGCCTGGTCTGGTTTCAGGGGCAGG


invisible?    
Gene introns: 0  

>4446 237 1235     10p11.21    chr10:37284003-37284141 BLAT!
GTCTGGAAGAACAGCTGCAAGGATGGGGAGAAGTGATGCTGATGGCTGATAAAGTCCTCC
GATGGGAAAGAGCCTGGTTTCCACCTGCCATCATGGGTGTGGTTTCTTTGGTGTTTCTGA
TTATCTACTATCTAGATCCATCTGTTCTGTCCGGCGTTTCCTGTTTTGTTATGTTTTTGT
GCTTGGCTGACTACCTTGTTCCCATTCTAGCGCCTAGAATTTTTGGCTCCAATAAAT


invisible?    
Gene introns: 0  

>1760 197 1233     21q21.3    chr21:29133558-29133754 BLAT!
ATAAATTATTAAATCCATTCCTTTAGTGTGTAAGTATTTAGAGTTTACAAATTACTGAGA
TTTAATTCTACAAATTATACATATTTACAATCTAGGTGAAGGCACTCAAGAGATATTTAA
ACATTTCCCCTCTAAGACATCAGTTTAAAGAAAGACAAAAAGAAAGAAAGAAAGAAAGAA
AGAAAGAAAGAAAGAAA


invisible?    
Gene introns: 0  

>33036 237 1225     3p26.2    chr3:3806409-3806173 BLAT!
TTTTCTGGGCTTGCCTAAGATCTTGAATATAAGTGTCCCTAACAAAAACGAGCCCTTGGT
GAGAAGGGTATAGTGAGGGTCCATATCTCCTGGCCATCTAACTCAAGACATTTTCTGGAT
TTCACCACCTCTTGATAGGAGGTATGACATTGGCAAACCATTTCATAAGACCTTCCTTCG
ATCACCCTTCCTAGCCACCTTCCATCCTGCCCTCTTTTGTTGCAAAACTCATCTGCA


invisible?    
Gene introns: 0  

>15327 289 1223     3q26.1    chr3:164101409-164101121 BLAT!
TTCTGAGATCATACATTCATAGCTTTAACTGTCAAAGCCATTGTGAATGATCTCTGAAGA
AACCCAACTACTCTAAATTTTCACTTGTATGTTTACAGGAATTTCTAGAAGACTTTAGAA
ATCATCATTCTGAATTCTTACTTTGCTTTGGGCAGCTAAAGCAGAATACCTGAGACTGGG
TAATTTATAATGAGTAGAAATTTATTTCTCACAGTCTGAAACTCTAAGATCTCATAGTCT
GAAAGTCTAAGATCCAGGGGCCAGCATCTGGCAAAGGCCTTCTTGCTGC


invisible?    
Gene introns: 0  

>24105 206 1222     Xp11.3    chrX:43888944-43889133 BLAT!
GCAGACGACGTTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGCCCTGTGAGAGAAC
CTATTGATAATTTAACTCCTGAGGAAAGAGATGCAAGGACAGTCTTCTGTATGCAGCTGG
CGGCAAGAATTCGACCAAGGGATTTGGAAGAGTTTTTCTCTACAGTAGGAAAGGTTCGAG
ATGTGAGGATGATTTCTGACAGAAAT


invisible?    
Gene introns: 0  

>14909 214 1218     5p13.1    chr5:42109318-42109530 BLAT!
CCCCTTACCTTTAGTTAAATAAATTAGAGTAGAAACAAAGGAATGTGGGGAATTTATCTA
ACTTGTTTACACATGTGGTCTTAAGACTAACCTTTGTTCTACAGTGGGTGCTTAATTGCT
TTCTACTCGGGAAGTCTATAATGTCAATTACCCTCTAGCGGTGTTGGCTCAAGCCTTTGT
CAATTAATCTTTACTGAATAAATGCAAGTCTCAC


invisible?    
Gene introns: 0  

>20969 198 1218     2p14    chr2:66469707-66469510 BLAT!
AAAAACAGCATGATTTAGCAAATTAAGCTTAGAGCCAAGGATATTAAATAGAGTTAACTT
TGTAGAAATAAATTCTGATACCACAGGCTTCAAACATTACTTTAAATGTGTTCATTTGGA
AAAAAAAACTAGTGAAAGGGCCCTGAAGGCCTAGGTTTGGGATGTTGGATTTTGTTTTTA
AGGGTGGGAAGAGTGAAA


invisible?    
Gene introns: 0  

>24578 262 1216     2q31.3    chr2:181654015-181654276 BLAT!
AGAACCTCCTGTCTCTCCAATAGCTGCTTCTCTCTAATTCTTCACCATAGTTTTCTTTCT
GTGGTCTTTTGAGGTTCTCTCCTCACTTTGCTTTTGACTTAAGTTCTCCACTCCTGACTC
ACCCAAATCCACGGCTTCACACGCCACCCAATTAATCTAAAATTTGATTCTCAGCTTTGG
AACGCTCTGCTGAGCTCCAGGTGCATAGAATCAACCTCACGAACATTTCAAGCTCATCAC
ATCTAAAACTAAACTCATTATT


invisible?    
Gene introns: 0  

>32338 234 1212     Xq13.3    chrX:74966464-74966231 BLAT!
CAACATCAAAACAGTTCCGTAATATCACGATTGCATCCCTGTGTGGACGCCAACAATTCA
CGTGCTTCTGAGATAAATTTGAAGAAACTACAACATCTTGAGTTGATGGAAGATATTGTG
GATTTGGCAAAGAAAGTTGCTAATGATTCATTCCTTATTGGAGGCTTATTGAGAATTGGT
TGTAAAATAGAAAATAAAATCTTGGCAATGGAAGAAGCTCTGAATTGGATAAAA


invisible?    
Gene introns: 0  

>33096 225 1212     2q22.1    chr2:141931083-141930859 BLAT!
GCTGAGGGAATGCCATGTGTAGCATGGGTTGGATTAATCAGAGTTCATCCCACAATCTGG
AGGTGGGTTCCATTTCTCCTGAGTCATGTATGCTTTTGTTGTGGAGGGAAATAATGGCTA
TCTGAACATAGTCAAGTTTATGTTAGGAAAAATAGTTGGAAAAAGCAAAACTGAGATGGT
TTATGTGAGGATGGAAGAGAAATGTATGGAATTAATGTCATGAAA


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>23612 207 1209     7q36.1    chr7:149876233-149876439 BLAT!
AATGTCTACCAAATAACCTAGAATATTATGAAAATATTCTCCATGTCTTGAAGAACTTAG
AAGTTCTCTTTCCTTTTATAAAAGAAAATCTGATGAAGGTAGAGATGATTTATTGCCTTG
AGTCTAGCCAGTCTGATGAGGACCAGTCCCGAACCATTAATGTGTGAATAATATATTTCT
CCTTCAACTGCTCTACCTTCTAAGGTG


invisible?    
Gene introns: 0  

>13517 224 1206     12q12    chr12:44207434-44207657 BLAT!
ATGAGTCTCATCAGTTCATTTCCCTAGGCAGTGTTTTCTACACTCTCAAAGAAGCTCATT
TCAAGGCCCTTCCTTACTCAGTGACTGTTGTTTCCTCGTGAACTGTTCTTTCACAAACAA
TAGCACAGGTCTAGCTAAATCACAGTTCACTTTCCCTGGCTCTAGTAGGTAACCTGCAAT
TCACTTTAGCCTCAATTTTGTTTCATTTTAAACTCTGTTTTTCC


invisible?    
Gene introns: 0  

Shown 601-630 from 3142 sequences on 21 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs