Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 661-690 from 3142 sequences on 23 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>11356 200 1147     7q36.1    chr7:150143601-150143408 BLAT!
AAGGATCACCCAAACAGAGAGGGAGGGGCAATTCCTGTAAAATTCCACAGCAACTTCATA
TGATCCCAGGGTTTTCCCAGCACCTCACTACTCATTCTTCTTCCTGGGATTTCCCCAAAT
TCTCCATATTTTTTCACCTATAAAAAGTGAGGGTCGGGTGCGGTGGCTCACCCCTGTAAT
CCCAGCACTTTGGGAGGCCA


invisible?    
Gene introns: LOC285972 (150130741 - 150145228)  

>17144 175 1145     7q33    chr7:137699027-137698853 BLAT!
TGCCATGTGAGACCTGCCTGCTTCCCCTTCCACCATAATTGTAAGTTTCCTGAGGCCTGC
CAACCATGGACAACTGTGAGTCAATTAAACTTCTTTCCTTTATACATTACCCAGTCTCAG
GTATTTCTTTACAGCAGTGTGAAAACAGACTAATACAAAAAGAAAGAGAGAGAGA


invisible?    
Gene introns: 0  

>25700 226 1141     Yp11.2    chrY:8401863-8401638 BLAT!
GATTCTTGTCAGAGGAGCCAAAAGCCTTCTGCAAAGTGCCAAAAATCTCTGTCCCCAGAA
TGAGAAAACAACCTGAATCCTGGAGCTCAGCCAGCCAAACAAAAGTCCCTTTTGATCTTT
GAAATCCCTGGCAGCAAAGTAATCTGTGATGAAGGGCAGTCATATCCAGCAACAGGCCAA
TGAATAAGCCCCAACACAAAGAGAAGGCCATGTAGATGAAATGAAA


invisible?    
Gene introns: 0  

>24845 205 1135     2p22.2    chr2:38044294-38044107 BLAT!
GAAATCTGCAGCTGCTGTAGCTGCTTTGGTGGCATCCTTATTCAGTGTTGCACCCCAAAC
AGCACCTTTATGACCCAAAAATGTTCCAATCCAGTCTCCTGTATCTCCCTGGCGTAGCAT
AGGTTTACCATCTTTGCAAGCGCTGATTAAGAAATACCCATAAGGCGTGATGCCACTGAA
GGCCAAATCAACCACGGGTCGCGTG


invisible?    
Gene introns: 0  

>11764 158 1131     13q21.1    chr13:57419497-57419340 BLAT!
TGCTGCTAAAGCAACTGTGGATGTTTACTCAGTAATTCTAAATGTGAACTTGCTATTTAG
CAAGTTTAAAGTCTGAAATATCATAGCCAGGCTGGATACATGAGCATGGACCAAACTTAC
TGCAACAAGTGGAAATCAATCTCCTCCTCATGAAAAAA


invisible?    
Gene introns: 0  

>28127 176 1131     5q21.1    chr5:102368468-102368617 BLAT!
GAGCGGCCGCCCGGGCAGGTTATAACTGGCTTTGAAGACTCTGTCCGAAAGTTTATCTGC
CATGTTGTGGGTATCACTTACCAGCACATTGACCGCTGGCTGCTGGCCGAGATGCTCGGG
GATCTGTCGGACAGCCAGCTAAAGGTGTGGATGAGCAAATACGGCTGGAGTGCCGA


invisible?    
Gene introns: 0  

>23984 241 1125     14q32.2    chr14:97042057-97041817 BLAT!
AAAACTTTGTCAAGTGTAATTAATGCCTTCAGATATGATAGGTAAAGCACCTCAACAACC
TCTAAGGCATCTCTGCTGAGGTTTCATTCACTCTAGTCTTAAGCACTTTTAAGGATTTTT
AGCTTTCCTTTTAGGAGGTCTTCTGTTTTAATTGGCTTAAAAAGAAAAACATTCTAAGAT
GCAAAACTTCTCAAGGAGAAACCATCCCAACCGATATGTAACATTACTTAAACATCCAAA
G


invisible?    
Gene introns: 0  

>18395 238 1120     8p23.3    chr8:1932934-1932697 BLAT!
GCCACTAAACTAATCACAGTTTGTTTCAAAAGTCTGCCACATGTGCCCAAATGCTATGAG
TTCCTGCTCCTGTGGGAAGTCAAGTTTGGAGTGCCTATCACACGTGTGCTTTTTAGGGGG
CCACTCACCTAGCTGTTCATGTGTGACTTTTCATTCATTTTTAAACATTTTTTTAGAGAC
GGGGCCACGCGTGGAGGCTCATGCCTGTAATCCCAACACATTGGGAGGCTGAGGCGGG


invisible?    
Gene introns: KBTBD11 (1922043 - 1955109)  

>6120 199 1118     Xp22.2    chrX:11584554-11584356 BLAT!
TGTGTATTAGCATAGCTGTAGGGCAGGGGAACTTGGGGATGAATGGATACAGACCTCAGC
AATTGTCCTAAGTCTGGTCTTCTTTCAGGTTTGTTAATTCACCACATTCTCATGTAATGG
AAAGAGTAAACATTCTCTATATGCTAGCATTATTTTACAAAATGAACACCAGTGAACCAG
ACATGAAAGCAGCATTTTC


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>24814 175 1111     2q37.1    chr2:235516052-235516226 BLAT!
AAAAATACAAAAAAATTAGCCAGGCGTGGTGGTGGGCTGTAATCCCAGCCACTCGGGAGG
CTGAGGCAGAGAATTGCTTGAACCCGGGAGGTGGAGTTTGCAGTGAGCCGAGATTGCACC
ACTACACTCCAACCTGGGCAACAGAGCAAGACTTGTCTCAAAAAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>5715 191 1110     2q33.3    chr2:207282389-207282199 BLAT!
GGCACATTGATTGCAGTAAAGTCCAGATGACTCTAACCACAGTCACCAACTGACGGCAAC
CATATGAGAAATTCCAAGTGAAACGAGCAGAACTGCCCACCTGAGTCAACCCATGAAACT
ATGAGAGATAATAAAACGACGGTTATTTTAAGCCACTAGGTTTTAGAGATACTTGTTAAC
AGCAAAGATGA


invisible?    
Gene introns: 0  

>5135 207 1109     2p23.2    chr2:29599722-29599516 BLAT!
AAACGAAAGAAGCTGAACAAATAGATTCAAATCTTTGGCCAGCCATGTGGAACCAATCAA
CATCTAGAGTAGGCTCCAAAATCCAGCTGGGTAAATGAGGGATTACTTCATGGGCTCCTA
GCAGCCTGGCCCAAACTGGGCATTTTCTCTTCCAACAGCAAGCAACGCCTCAGCAGGATC
CTCAGTCTGTGCTTGTAAAATGTAGAT


invisible?    
Gene introns: ALK (29415639 - 30144432)  

>13191 202 1109     7q22.1    chr7:103012708-103012507 BLAT!
ACTCTCTTTACTAATTTAATTCAAAATAAACTCCTCCTTTTAATCAAAACTTTAACTAAT
TCTAGAGTGAAATTTAGATTGGCTTAGTTATTTCCTTTGCAATCATCACCAGATCAGATA
CATCTGCATTCTGATACGGACTGCCTTCTGAAAGAGCATGTAGTTGCAGAACCTCAGCTT
ACACTAGAAACTTTTGTAAACG


invisible?    
Gene introns: SLC26A5 (102993176 - 103086624)  

>1891 139 1107     8q13.2    chr8:70042126-70042030 BLAT!
CATCCTTCATGGCCCGGTTTTCGATGACCTTCATTCCTCTCTCGCTCTCATCAGCCGCCT
TCTCGGCCTCCTCCAGCTTCTGCAGGGCTGTAGCCAGGCGCTCCTGGGCCCCCCCGCGTA
CCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>26261 230 1107     20q13.2    chr20:49950838-49950609 BLAT!
ACACATGACTGATCCCTACCCTTCCGTATTCGTTATCTGTTGCTGTGTGGCACATCTCTC
CGAATGTAGTGCCTTAAAACCACATCTATTATCGCACCGCATCGATAGGTCAGGAATCCG
GGAGCGGCTTCACTGAGTCCTCTGGCTCCAGGCGTCTCCCAGGGTCATAGGCATCTCAAG
GCTTGACTGAGAAGGGCCCCAGCTCGCTGTTGACAGTGGGCTGTTGGCAG


invisible?    
Gene introns: 0  

>27781 211 1107     14q31.2    chr14:84759352-84759142 BLAT!
AGGATGTTTAAAAACATCCCAGAGTGGGTATCTAGCAGATGCCCATAGCAGCTGCGGTCA
CAACCATCAAAAATGTCTCTGGAAATTACCAATATCCTCAAGAGAACAACATTACTCACA
ACTACACGCCTCTACTCTAAATAAAATGCAGAAATACACGATGTAGATGGTGCTCCCCAC
TCCCATTCATGTCCACCTGGAACCTGTGATT


invisible?    
Gene introns: 0  

>2976 162 1101     7q11.22    chr7:67128694-67128533 BLAT!
CACCCATGTCCAGTAGCTTGGCTGCAAAGTCCTGTCTTGTCTGCAGGTCAGGGACAGTTG
TCCCTGCACACACAATCTGTGGGCAGGTTATAGCATGCTGTTTTGACTTGTTGACGTAGC
AAATTCTTGCATCCACCTTAACACATCTTGTCCCCGAGCATC


invisible?    
Gene introns: 0  

>25401 297 1100     10p11.1    chr10:38369232-38368936 BLAT!
GAGCAGGAGTTCCGGATCCAGCTTCTTGTCTTCAAACACAAGATGAAGAACCTCGTGTGG
ACCAGCGGTATCTCAGCCCTGGATGGTGAATTTCAGTCAGCCTCAGAGGTTGACTTCTAC
ATTGATAAGGACATGATCCACATCGCGGACACCAAGGTCGCCAGGCGTTATGGGGATTTC
TTCATCCGTCAGATCCACAAATTTGAGGAGCTTAATCGAACCCTGAAGAAGATGGGACAG
AGACCTTGATGATATTCACACACATTCAGGAACCTGTTTTGATGTATTATAGGCAGG


invisible?    
Gene introns: 0  

>9180 184 1097     14q24.1    chr14:69334803-69334620 BLAT!
ACAGTTGAATTCTGCAGCACCCCAGCTGAGAAAATGGCTGAAACGGTTCTAAGAATTTTA
GATCCAGTTACCTGCAAAGAGAGTTCACCTGATAATCCATTTTTTGAGTCTTCACCAACC
ACCTTACTTGCTACAAAGAAAAATATTGGACGATTTCATCCCTATACTAGATATGAAAAT
ATAA


invisible?    
Gene introns: 0  

>11828 215 1095     3q28    chr3:190661601-190661387 BLAT!
AGTCTGTAAATAAATATCTCAGAGCAACTACTTCTGTCAGGAGTAACAATATTTTGCTTT
CCATGCTTCTAGAAAGAAAACAAAATATGTTTCACTATGGAAACAGTCAAACCCTATTAC
CAAGGTCACATTGTAGACCCATAAAAATAGTAAACCTTTAAGGTTTAGAAATTTAACTAT
GATCTAATGGAGGATGATGTGCAATGCATTGAGAC


invisible?    
Gene introns: 0  

>4787 269 1092     Xq28    chrX:149400507-149400239 BLAT!
TGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATCATCAGCATAGCAG
AGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAAGACCTGTTGCGGA
AGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAGCTGAAGCTCAACA
AAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTCAAGCCTCCTC
CAATAAAGCTCTATCGGGAAACAAATGAA


invisible?    
Gene introns: 0  

>14679 236 1092     3p13    chr3:70174942-70175167 BLAT!
TGCTTTATTGTTTTAGGTCTTTTGGGCTGAAGATTTGCTAGTTCCATTAATTTGTTCATT
CTCTGTCGGTCCTCATCATCAGTGCTTTCATATTCTGATTCTTCACTAGATAATTCCTCA
TCCTCGTCTGGCAAAGGAGGTTCCTCAGGTGGCTGAGGAGATGTGGGTGGAAGAGGTGCA
TGCAATGGCATATAGTCTTCATACATGGGAGGTCGCGCAGTAATTGGTCCAAAAGG


invisible?    
Gene introns: 0  

>25572 183 1092     10q26.11    chr10:120053258-120053076 BLAT!
GGCATCTCTGCAGGAGAAAGCAGAGGTAAGCAACAGGGCATCTGAGAGATCAGAGAAAAC
TTCCAAATAGCCACCAGGTATGTGCTGGAGAGCAGGATAGCTTCAGAATAGACACCAGAT
ATGCACGGGGAAGCAGAGCAACACAATTTGGGAACAGGTAAAACTGAAAGGGTGGGTGCA
AGA


invisible?    
Gene introns: 0  

>5986 131 1091     2q35    chr2:220729190-220729320 BLAT!
CCCCCCGTTAAAGAGCTGCTTTTCAACTGTGTTGGGCTTCTTTGATCCCTGAAGTCTCCT
GATGTTTTGCTCACATCCTGTCATGATATTTAATGATGCTTCATGTGTGCACCAGGAGCA
CGGCCCAACTT


invisible?    
Gene introns: 0  

>25434 190 1090     2p24.3    chr2:15145378-15145567 BLAT!
AAATGTACACCTGTTGACTAGCAACTCCCCTTACTCGCTCCCCAACATCCCTGGCAGCCA
CCGTTCTATTCTGTTGCTTCTATGAGTTTGACTATTTTGCATACTCATATTTTAAAGGGG
TAGGATTATTTATTTGGAAGAGCGATTCATTTAGTTATTCATTTACACAATGCACTAGTC
CTTTTCATCA


invisible?    
Gene introns: 0  

>29839 179 1089     4q13.2    chr4:68096261-68096439 BLAT!
GGAAATCAAGAAAGCAGTTGCCAGCAAACGATTTGAGGGCAACATTAGAAAGAAGCTGCC
CTGGAAAGTCAATGATAGATATATTTAGTCCTTTAGAGATCACCATTTTACAGATGAGGA
AAATGTGACCAAATGAAATTAAGTGATCTGTCTTTAGCCATTTGCCTATTTAATTGATA


invisible?    
Gene introns: 0  

>32118 252 1088     Xp11.23    chrX:48634603-48634836 BLAT!
GAGCGGCCGCCCGGGCAGGTACTGGGGAGCAAAAGCTTCATTCACCTCTACCAAATCCAT
GTCCTTAAGACTCAGTCCTGCTTTCTTCAGTGCCCCACTGATAGCAGGGACAGGACCAAT
ACCCATGATAGAGGGATCACATCCAGATACAAAGTAGCCCACAATTCTTGCCAGTGGTGT
GAAGTTATGTTTCTTAACAGCATCTTCACTAGCTATGATAACAGCTCCAGCACCATCAGC
TACACCCGATGC


invisible?    
Gene introns: 0  

>11745 262 1087     4q32.3    chr4:166586166-166585999 BLAT!
CTGTATCTGGATCCAGAGTCATACTAACTTGATGACTCCTTAACATTTTCTTCACATCGA
AGTAAAGCTTGGAAACATTGCACATAGTATGAAGTTCCAAGGAGACAGCCTCTGATGTTT
CCAGCTTCACAGCCCAACTCCTGCTCAAAGTGTCATTCACATTCTGCAGCAATTTCTGGG
CTGAGCCCTGACATTTTTCCTCCAGTTCCAGGATGTGGCTCTTGAGTTCATTGCTCTTCA
GCCCCAGACCAGCCTCATAGTC


invisible?    
Gene introns: 0  

>5929 183 1084     10p12.2    chr10:23859764-23859946 BLAT!
CTGGAATGAGTAATCAGCAGTGTTGATTCCAAATCTTAGTGAGACCTGTGCCAAACCTTG
GTTTCTGGGAGTCTTCACAAGCATCATGAATAGATGAAAGTTTTTATATTTAGTTGTTGT
GCTGTTTCACTCCAATAGCAGAAAGAACAAAGAACAGAGACAGATGGGGAGTGGAGCAAG
ATG


invisible?    
Gene introns: 0  

>11333 240 1081     1p36.21    chr1:13021226-13021438 BLAT!
GTATATGGTGACTTACTTTCCAATCTGACTCTGGCATAACATCCTGTGACAGAGGAGAAA
GTCAAGATATTTTGCCCCAAGGCATGTTTCTTTGCCATATCTTGAAATGGCCCTGCAAAG
CTGTCCTTTATGGGGGAAAATCTGCATCTGTAAAGAATCTCTATTAACACAGCTAGATCT
TTTTCTTGCAGGCCCTCCCAGTCCTGAAGAGATTAAGAGTCTAGCACCTTTTAAGGTCTG


invisible?    
Gene introns: 0  

Shown 661-690 from 3142 sequences on 23 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs