Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 691-720 from 3142 sequences on 24 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>5283 172 1080     Xp21.1    chrX:31683160-31682989 BLAT!
GAGCATTTATATTCTCATGTGGACAATTATGGAATTGCTCAAAAAGGAAGAAGATATCAA
AAGATGAAAGTGAATATGTAGGTAGGGGTCATATATTCGAGGGCCTTGTAATCCAAAGAG
AGAGGTTAGGACTTTGTCTTGCAGGTAATAGCAAACCATTGAAAGGTTTTAC


invisible?    
Gene introns: DMD (31137344 - 33229673)  

>30073 233 1080     3q25.32    chr3:158602170-158602402 BLAT!
ATTCTAATATAAAAATTCACAATGAACAGGGATTGATATCATTGGATGTCTGTCCTTTCC
AAATCTTGTATTGAAATGTGATCCCCAGTGTTGGAGGTGGGGCCTAGTGGGAGGTGTTCG
GCTCATGGGGATGAATCCCTCATGAATTTCCTGGTGCTGTCCTCATGTAATGAGTGAGTT
TTTATGAGATATCGTTGTTTAAAAAGAGCTTGGCACTTCTGCCTCTCTCTCTT


invisible?    
Gene introns: 0  

>7595 217 1074     10p14    chr10:8288159-8287943 BLAT!
CAAGGAATCATCAAGTTTTAAAATCTCACAGTCCTAGGACTCTAGAACCTAGGACCCTGA
CATCCAGTATGACAGCCTTTACGTTAGACCAGTGATTCTCAAAAGGTGATCCCTGGACCA
GTAGCAGCATATTACCTGGGAACTTCCTGGAAATACAGATAATCAGGCCCTACCCCAGAC
ATACTAAATCAGAAACTCCGGTGGTGTGGCCCAGCAA


invisible?    
Gene introns: 0  

>32029 298 1072     6q16.2    chr6:99623484-99623188 BLAT!
ATTAAAAAGAGCTTATTTTCATTAACATGTGATTAACAGGAAGGAGATGATTGGTGAGTT
TTCTTCGTAACCAGGTTCACTGTGGATAGGAAGGGCCTGCCTTCCTTCCCACCATGGAGA
TCCTAAAATCACAAGCTCCAGCCTCCATCAATGATGACAGGGTTACCAGTTACATAAGCA
GATTCATCAGAAGCCAAATACACGCAGAGCATGGCTATTTCTTCTGCAGTTGCGAATCTT
CCCGTCTTTTGTCTCTTCAGGAAATCATTCCGTGCCTCTTCAGGATTTCCTCTGGCTT


invisible?    
Gene introns: 0  

>4673 187 1070     21q21.3    chr21:29230151-29229965 BLAT!
ATGTTGAATTATCCCTTCACATGTAATGTCCTGACACTTATTTTTTTTACCAGCATGCAG
GGAGTAGATATTCAAAATGATTGCATAAATGTATACAAACTAGAGGCTAGGAACTGGTAA
GCCTTGTCCAGATGACAAGACACTCTTTGCTAAAATTAACATTCTCTTTCACCTCAGAGG
TTTCATC


invisible?    
Gene introns: 0  

>10231 106 1068     2q31.3    chr2:181665399-181665476 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGAGGCCAAGTCAATTTTTCAAGGTTACAGAGC
TATTAAGTGGTAGCACTGGAACTCTAACCCAGATAATCTTGCTCAA


invisible?    
Gene introns: 0  

>1274 161 1067     1p36.21    chr1:14578437-14578277 BLAT!
GCACAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGATCGAGGCAGGTGGATCACTT
GAGCTCAGGAGTTCAAGACCAGCCTGGGCAACATAGTGAGACCCCGTCTCTACAAAAAAT
ACAAAAATTAGCTGGGCTTGGTTGCATGCATCTGTAGTCCC


invisible?    
Gene introns: 0  

>10254 199 1066     Xp22.13    chrX:17896227-17896425 BLAT!
GCATCCTGAAAATGTGAATCAAGCTTCCACAGGTGTCTGTCTTGCAGTTAGCTTATGCTT
CTGCCTGAGGTGTAACTGGTTTCAGTGGTCTTAGCTTCCTTTTGCATGTCTCATGATATT
CATAGTAAAAGTTATGATGCTTTGGTAATTTGAGATCTCACCTCACAGCTGAGCTATTAA
ATCATGACTGTTTGAGGAG


invisible?    
Gene introns: 0  

>10319 221 1066     2q31.3    chr2:181780665-181780885 BLAT!
AAAAAGTATGCAAAAAAGACTAAATATCCAACTGTATTTGCAACGTATATTTTTGAGCTT
TCTCAGTTTAGATCTGAATTATATAGTTATAATGATTTTGGATTCAGTTTTTTGGTTGAC
ATTATTTAACATACAATTCCTCAGACCAACTTTGTCGAGATATTTCTCTTCTGCAATGCC
CTTACAGTATTCTATAGTGGATTTCTTAACTGTCTCCAAAT


invisible?    
Gene introns: 0  

>5790 194 1065     8q23.3    chr8:117476359-117476552 BLAT!
GGTTGAGCGAAGATTAAATGAGTTAATACATATAAAGTGCCGAGAGTAACCCCTGACACA
TTGTAAGCTCTTAATAAATGTGAGATCCCGTTGCTCATCATAAACGCACATGGGAAACTC
GAACTGTGCACCCCACTCATTTCGGAAGACAAGGCTAGGAAAAATGCCACCCTCCGAAAT
TGAAACAGGTGAAA


invisible?    
Gene introns: 0  

>17445 219 1065     Xq22.3    chrX:105516617-105516835 BLAT!
GAGCAGCTAAGGATAATTTTAATGTCACACACCACTTTCCGTAGCAGAGCTACACTGAAA
CCTCATCTACCTTGCTGAATGATGCTCTCACTGGAAAACTAACCCACAAAATGACCACAG
TATTTTACATCTGTGCGAAACTATGACAGCCCGAATGTGCGTCAAGATATCTGTCCTGCT
TTTCTCCTCGCAGAGAAACTGCTGAAAACTATCCCTTAC


invisible?    
Gene introns: 0  

>18975 188 1063     5q31.3    chr5:141543198-141543385 BLAT!
CACCGCGCCCAGCCGATGATGGTGTTTTTAAAGCCAACTTCTAATACCTCTTTTTTCCAT
TGCTTCATTGCCAAGAGGAATAATTAGACTGTTGCAACAATTATGACAAAGGCGTCCTAT
ACCCTTGGTCTTCTTTCATCCATAGGGCATCCAAAAGAGACCTGGTTTCTCTGTTGATTG
GAAGTTCA


invisible?    
Gene introns: 0  

>20154 203 1063     3q11.2    chr3:94462213-94462011 BLAT!
GGCCTCCCAAAGTGCTGGGATTACAAGCGTGAGCCACTGCGCCCTGCTGATACTGTTCTT
TCATTCCTAGTTTAGTTGAGATACTTTATCTCTTGTCACTTCTCCTGTCTTTTACTCCAC
TTCATTCACACTGATCTTGTTATTTTCCTCACAACTCCAAGCATGCTCCAACTTCAAGGC
CTTTGCACTTGTGTCCTGTGTGG


invisible?    
Gene introns: 0  

>5110 248 1061     Xq21.31    chrX:91368814-91368595 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGTGCCTTCTGATGTGCTTGAGGTGACCAAGAAG
TTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTATC
CGCCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAGCTGGACACACTATGTGACTTG
TATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATCAACACCCGGAGGAAGGTGGAC
TGGCTCAC


invisible?    
Gene introns: PCDH11X (91090459 - 91878228)  

>10850 190 1060     13q14.3    chr13:54528271-54528083 BLAT!
GTTAAAAAAGAATAAAATTCTGTAGTAAGCATCAGCTTGGATGAAACTTGAGGACATTAT
GCTAAATGAAATAAGCCAGCCAAAGAAAGACAAATGCTGCATTATTCCATTTATATGAGA
TATCTAAAATAGCCATATACATAGACTCAAAAAAGCAGAATGGTGATTACCAGGAGCTGG
TGGGAGGGGG


invisible?    
Gene introns: 0  

>16821 247 1060     21q21.1    chr21:20139081-20138835 BLAT!
GTTCTCTAACCCTGTTGTATTGCTTCTGGGCCATATTTTTCAAGAGGTGTGGTCTACTCT
TAGGGAATCTGGTTACCAGTTCTGATTTCCTTATGTTTCTTCTTGCAAATATAGCAGTTT
CTAGCACACCTATACCTCTGAGTTTTTACTTATTGTTGGGCTAGAGTAAGACACGGTTGT
GTATCTCCCCTTTTATCTTCTTCTCTTGTGTCCTTGTCACTTATCCTAAGCAGGAAGGGC
AAGATTT


invisible?    
Gene introns: 0  

>30447 190 1059     14q23.3    chr14:66523101-66522912 BLAT!
TTTCACTCCTCAATAGCTCACGTTCTCACCTCTCCCAGTGCCCCTCCTGCCCACCATAGA
AGGGGCATTGGTATTTGAACCACAGCTGGTCTACAGAATTCAGAATCCAGAATGCAAGGG
AAAAGAGCCCAATGTCATATTAAAACCAGGAGCCACCATGGATCTAGAAGGCAGAAGCCA
GGCTGGATCG


invisible?    
Gene introns: 0  

>9969 204 1058     8q24.23    chr8:138710584-138710392 BLAT!
CTCTCCCCAGTCTCCGGCTGCACCTCGCTTGGCATCAAAGGAGTTGTCCGCAACTCGTGA
ATCCACCTCAATTTCCTCCTCCCTGACCCTTCGGAATGGGGATGATGCCCTTTTTTCTCC
TTTCTTCCTTTTTGGAAATGTGTTAGGGGTCTGAAGCTTTATCTTCTTGGCCTGAGGAGT
CTCTGCCTCCTTGGCAGCCTCATT


invisible?    
Gene introns: 0  

>12764 164 1058     6q14.1    chr6:80776183-80776020 BLAT!
GAGCCTCTCTTCACAAATGATAAATATGCTGATTTTATTGAAGCCAATCGTAAAGAAGAT
CCTCTAGATCGTCTGAAAACATTAAAAAGACTAATTCACGATTTGCCTGAACATCATTAT
GAAACACTTAAGTTCCTTTCAGCTCATCTGAAGACAGTGGCAGA


invisible?    
Gene introns: 0  

>13589 197 1058     6q22.1    chr6:116936825-116936629 BLAT!
ATAGTATACAGTCTCCAATATGAAGAAGGTATAGAAGATTGGACCATATCTGGACTTAAC
TATAAACCATATATTAATTAAAGTCTTTAATGTTAATTGTTTTGTATTTCTTTCTCTTTC
TAAATATACCAACAAATACTTGGCATTTGACAGTTTACATTGATATAGCTTCTATTTAGC
AAGATGTTGCTCTAAAT


invisible?    
Gene introns: 0  

>413 215 1054     18q12.1    chr18:26233223-26233045 BLAT!
ACCTTGCAGCCACATCTTCCTCACCCCGGCACATCCACATCCCAACTTAGGTGTCATGGA
AATCTTTCAGCAGGGTTCTCCTCCGCTGCTCCGCTATATGCATCTGGTTCTCCAAGTCCC
CTCTGTCATAGCTGTCTGCACGCTCCACTTTCCATGAGAGGTTTTCGATCTCAGCCTCCA
GCTGAGCCCCCGCGTACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>30945 202 1054     13q32.3    chr13:100236667-100236466 BLAT!
TCAACGATGTGCATCTCAGCCTTGGAGGGGAGGCTTCGTCCAAGCTTGTCTTCCTTGAAT
ATTTTGCCTCGGCCCTAGAGGTAGTGTTTTTTCTCTACATCTGCTATTCCTATAATCTGT
CTTGTTTTGTTTTCTAATTGAAGTCCCTTACTGGTCCTGCTTCTACGAGTGGCGGTGACC
AGGTGAAAAGGGCGAGGAATCA


invisible?    
Gene introns: 0  

>5967 238 1048     20q13.12    chr20:44308287-44308524 BLAT!
ACTTTCATATGTTTTCCAGTCACTAATTAGTGTCCTCTTCTTCAGCTTGAAGAACTCTCT
TTAGCACTTCTTGTAAGGCAAGTCTAGTAGTAATAAACTCTCTCAGCTTCTGTTTGTCTG
AGAAAGTCTTTATCACCCCTTCATTTTTGAAAGAAAAGATTTCTGGGTATAGTATTCTTG
GTTGACAGGGTTGTTTTATTCAGGATTTTTAATATAACATCCCACCCCCTTCTGGCCT


invisible?    
Gene introns: 0  

>3608 168 1046     5q32    chr5:147306963-147306796 BLAT!
AGTTTAAAGTTTTTCAAACCTAATCAAGTCAAATAAAGATTTGTTATTTAAAAAAATAAA
ATTACATAATGATTTCGTATTGGGAATTGCAACAGGAATTGCTTTTTAAAAAGAGCCCCA
TTTAACCCCACCCAGGCTGGGTGGCACCCAGATGGCTTATGGGTAGAA


invisible?    
Gene introns: 0  

>4131 193 1045     5q11.2    chr5:57722204-57722396 BLAT!
AGTGGCAAAAGACATGGCCCCTGCTCTTAAAGAATTATTTTTAGAGACATCAGGGGGCAT
CTGAGATTAGTTCAAGGAAAAATTCTCCTGCCTCCCTTCCTCTCTCTACCTCCCTAAATC
TACAGGCCATAAGCAGTGAGGGTCAGGCACTCAGGAGTGGGTGATACTTTTGTGTATGAT
TCCATGTTTCCTG


invisible?    
Gene introns: 0  

>31178 172 1045     22q11.21    chr22:19622721-19622892 BLAT!
AACAAGAAAGACAGGAGCAAATAGACAAGGGCCTAAGAGAAATAGAAGTTGAAAAGAAAG
AAAATCTTTGAGCATAAAGAAAAGAGAAACACGTAAAATCTCACTACAGACCAGCGCTAA
CAGAAGAACATTTCAACTTGATGACAGGGAACACTAGTTTTGAATCTTGATT


invisible?    
Gene introns: 0  

>16089 207 1044     2q22.3    chr2:146214556-146214350 BLAT!
GACTAAAGTTCAGCTTAGAGTGGCCCCCAGTGGTCTTATTCCCAATAAAACTGGAACAGA
TATATTGGCAATGAGAAAAAATTCCATGTTGGATCCTTCCTGTGGGAAAGGTTGAGTGGA
AACCTCCAAAACTGCCTCCCACTCCTGGCCAAGATAGTAATGTAATTCAAAACATATTGC
ATTCTCAGTGTAGACAGGTAGGAGATG


invisible?    
Gene introns: 0  

>3056 173 1043     2q31.1    chr2:172348312-172348140 BLAT!
ACTTTCAAATTCCTTTGGGTTATAGTTGGAAACCAGGATGGGAATAAAGGGATCCAGGGC
ATCAAATCCTTCCTTTCCCAGCAACTCCTGGGGCAGATAGGCTTTCCGGGGCTTAAAGAG
AGACCCAGTCTGGCTCAAAGCCGACACAATGGCGCCTCCATGCCAATCATTTT


invisible?    
Gene introns: 0  

>23814 104 1043     1p35.2    chr1:30648051-30648131 BLAT!
AATTTTTGTATTTTTAGTAGAGATGGAGTTTCACCATGTCGGCCAGGATGGTCTCAATCT
CCTGACCTCTTGATCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>24822 174 1042     3q26.2    chr3:167898578-167898752 BLAT!
AATGATAGAAACGAAGATATAGAAAATCTGTTTAGAAGATTTGATGATCACGAAAAATGA
TATTTAAGAAGTAATTATTTGGTTAAATGTTGGAGGCACCAGAACATAGTAGTTAAATAC
GTAGGTTTTGGAGACTGATTGGGTTTTAAAATCCAGCTTTCCCACTTGTTCTGT


invisible?    
Gene introns: 0  

Shown 691-720 from 3142 sequences on 24 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs