Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 721-750 from 3142 sequences on 25 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>3258 229 1041     6q22.31    chr6:120455341-120455569 BLAT!
GTAGAATCAATGGGAGACCTGAGCTTGTTTTCCTGCAACTAGATGATCCCATCTGGGTGT
GATGGGAGACAGTGACAGATATCAGGCATCAGATTCTCATAAGGAGCACACGACCTAGAT
CCCTCGCCCGCACAGTTCACCATAGGGTTCATGCTCCTATGAGCATCTAATGCTGCTGCT
GATCTGACAAGAGTTGGGCAGTATTGTAAGCCATGGGGAGCAGCTGTAA


invisible?    
Gene introns: 0  

>9716 214 1041     5q11.2    chr5:57721761-57721548 BLAT!
ATTTCTAACAAATTTCCGGGTGTTGCTAAGTCTGCTGATCCTAGATCACTCTTTGAAAGT
GACTAGGCTAAATTATTTGGTCATTTGGTAAATGCTGTATATATTCAAGAAAGGATTAAT
AAAAATCATGGAAGAATTTCTGAAAATAGGGCTTTGTATGTAAGGAAGGTATAGATGTTC
ATGATTTGGTAGGTGCTTGGCTTAACTAAACGTG


invisible?    
Gene introns: 0  

>9154 195 1040     7q32.3    chr7:131444507-131444313 BLAT!
CTTTCCCTGAGTCCTGCAGCTCCCTCTACACTGTCAAACCAGGTGTGTGCACTTGGACCA
GCATCTTCAAATCTTTAAATGCATCACGAATGGCTTTAACTACAACAGTGAGGACGGGAA
GAGACCAGCAACCAGAGCAGAGCAAAAACTCCATTAAGTTGCATCAAAGGCCCAGGTGAA
GCAAGAGAACATAGA


invisible?    
Gene introns: 0  

>18566 219 1039     10q21.3    chr10:66221946-66222164 BLAT!
GCCTTGTCACCTCTGCCTTTAGAATATAACCAGAACTCAAACATGTTTCATCGCTTCCCC
TGCTCACCAACCTGCCCTTTACCTGGGCTTTTGCCAATAATCTCTTAACCTCGTCTCCCT
GCCTCCATTCTTCTATCCTAAAGTCCATCCACAGAGATGCTATAGTGGTTCCTTTAAATG
ACACATTAGATATTGATAGTCTTCTGCTTGAAATGTCTA


invisible?    
Gene introns: 0  

>20086 259 1039     18q21.32    chr18:57865162-57865415 BLAT!
TATATGTAGCTGTTGGAGAACTTCTACGACATTTCTGGTCCTGCTTTCCTGTTAATACGC
CATTCCTAGAAGAAAAGGTAGTGAAAATGAAAAGTAATTTGGAACGATTCCAAGTTACGA
AGCTCTGTCCATTCCAAGAAAAGATTCGGAGACAGTATTTAAGCACAAATTTGGTAAGTC
ACATAGAAGAGATGCTCCAGACAGCCTACAACAAGCTCCACACATGGCAGTCACGGCGTC
TGATGAAGAAAACGTGAGG


invisible?    
Gene introns: 0  

>19940 186 1037     1p31.1    chr1:78620603-78620788 BLAT!
ATAAATTTATAGACTATGAAGGAAGGGAAATTGCAGGCTATAAAAGAGGAGGACTGATTG
TAAGGTATATCAGAGAAATGGAAAAAAATGCTAATTGAAAAGCATGATGTGGTAGGCAGA
CTTCAAAGATGGTCCCTATCTTCTGCTATTCATGCCCTTGTGTGATCTTTTATCCTTGAT
TGCAAG


invisible?    
Gene introns: 0  

>7353 190 1035     11p15.1    chr11:19932906-19932717 BLAT!
GAATACGCTTTCCTTATTGTATATAGCTAATGCACCTTTCAGCTTAGACCTCACTTCTTC
CAGGATATCTTCCTGACTCCTCCAAGATTGGATTGGATGCTCCTTCCAGACATAAATGTC
CTATAGACACTTATCACAGGATATTACAAGTGTCTGTTTCTGTGCTACGTGTCCTGTCCC
TATTCCAAGC


invisible?    
Gene introns: NAV2 (19734880 - 20143147)  

>27691 189 1033     2p12    chr2:76762149-76762337 BLAT!
GGGCTTTGGACATCCAAAACTCAGAGAGAAATAGGATTAGATTAAAATGGGCTCTGATGC
TAAAATTTAAAATTTATGAGAAAAAAGAAGCAAAAGAGGAACACATTTAAACTGAACAAA
ATGAGTATCTTCATATGGTAAAAGAGGAAGGAGACCCGCTTGCAATTAGTTTGAAAGAAA
CTGGGGAGC


invisible?    
Gene introns: 0  

>1922 188 1032     13q32.3    chr13:100236666-100236479 BLAT!
CAACGATGTGCATCTCAGCCTTGGAGGGGAGGCTTCGTCCAAGCTTGTCTTCCTTGAATA
TTTTGCCTCGGCCCTAGAGGTAGTGTTTTTTCTCTACATCTGCTATTCCTATAATCTGTC
TTGTTTTGTTTTCTAATTGAAGTCCCTTACTGGTCCTGCTTCTACGAGTGGCGGTGACCA
GGGGAAAA


invisible?    
Gene introns: 0  

>384 148 1029     1p31.1    chr1:73915772-73915919 BLAT!
GAGAAATGCAAATCAAAACCACAATGAGATACCATCTCACACCAATTAGAATGGCAATCA
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTAC
ACTGTTGGTGGGACTGTAAACTAGTTCA


invisible?    
Gene introns: 0  

>31212 204 1029     4q31.22    chr4:147056783-147056580 BLAT!
TTGAGGGTAGATCTTAGAAGGGTAGGTTTTTTTACGACCTTTTTTCGGGGGCAGGGGGTG
GGCATCAGAGCAGAGGTTCACAGCTTCTTTTCATTAATAAATTATTTAAACTCATAGGAG
GTTAGCTTTCCCTATCCCACTCCTATAACCTTCCTAGTCCTTCTTTAGCCTCTTAACTGA
TTTGAGGCCTTTATCCATGAGCTA


invisible?    
Gene introns: 0  

>16162 244 1027     3p26.2    chr3:3809836-3809592 BLAT!
TCAAAATCTAAACATCGTTTTGCCTAACTTGTGAATTCATTTTAGTAGATCAACTGTGTA
AAGGATTTCATTATACAATAAAATAATAGGAAATCTGTTTTAAAATGATTAAAAGGATTA
GCTAAAGATGAATGTATTCCTCTAGGAGTTTCTGGCAGAAAAAAAAAACACATTATTCCC
ATTAAATGGGTGTAATAGATCTTCCTCTTTCAGAATTTCTGCAACTCTTTCATCTTGCGT
TAAC


invisible?    
Gene introns: 0  

>16796 183 1026     19q11    chr19:27750180-27750362 BLAT!
AGCAGTTTTGAAAAACTCTTTTTGTAGAATCTGTAAGTGGACATTTGGAGCACTTTGAGG
GTTACTGTGGAAAAGGAAATACCTTCACATAAAAACTAGACAGAAGCATTCTCAGAAACT
TCTTTGTGATGTTTGCATTCAACTCACAGTGTTGAACCTTTCTTTTCATAGAGCTGTTGT
GAA


invisible?    
Gene introns: 0  

>14166 147 1025     10p15.1    chr10:4246288-4246142 BLAT!
TCCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGTGCCTGACCAACCTGAAGCAATTTA
AGTGGACTTTCAAATTTTCAATTTTCCCATTGGGAAAGTGTAAGTTTTGGGAAAAGTCAG
TAGTTTTTACATTCTTTTGTTCTGATG


invisible?    
Gene introns: 0  

>28769 217 1024     18q12.1    chr18:26233227-26233045 BLAT!
GGGAGACCTTGCAGCCACATCTTCCTCACCCCGGCACATCCACATCCCAACTTAGGTGTC
ATGGAAATCTTTCAGCAGGGTTCTCCTCCGCTGCTCCGCTATATGCATCTGGTTCTCCAA
GTCCCCTCTGTCATAGCTGTCTGCACGCTCCACTTTCCATGAGAGGTTTTCGATCTCAGC
CTCCAGCTGAGCCCCCGCGTACCTCGGCCGCGACCAC


invisible?    
Gene introns: 0  

>29620 178 1023     3p26.3    chr3:1492448-1492271 BLAT!
ATAAGAGGGCCTGGGAGGATTATTCCTAGTATTTTCCCATAGCTACTCATCTATACTGGA
GACTGACTTTGATAAAATGTTAGAAAGTGAAGGGTAAATAACAGGGCTTAGAGCCACTCC
CACCTGTGTTTGTGTTAGGACAGTTCTGAGTTTAGTTAATTTGGAAGCAACCTGGTAG


invisible?    
Gene introns: 0  

>29535 165 1021     4q22.1    chr4:92141045-92141209 BLAT!
TAGATAGAAATTTCTATGTAGAGTATTTCCCATACTTTCATTTGACCAGTGTTTTTAGAA
CCTCTCTTAAAATGTAAATTTACTCAAAACGTCATATATAAATCAGTTAAACCTAGAGTT
CTTCTAGTTCAAGTGAGAATGGGAGATCCACAGTTTATCCCTTTT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>26581 210 1020     11q14.1    chr11:79698831-79698626 BLAT!
ACCGCCCAAGTCTCTTGAATTCTTCTGGAATCCAGAATGTGATTTTTGCAGAAATTCAAT
CAGATTGTCAAACAAGTTTTTATTTAATTCCTCTTGTAGTCGCTCATTTTCAGATTTCAT
CTGCTGCCATATCAACTGATAAGTTTCGAATCGAAGCTTACTGTCCTCAGGCTCATTTTT
CCCTTTGTTAAAATAGTCCTCTATTGGCAG


invisible?    
Gene introns: 0  

>2124 165 1017     4p15.33    chr4:11306399-11306535 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGGAGTTGTCAGTTTTGGAGATACCTATGCAGC
CTGCAGCCATTTCTCTTCAAACAGATCTAAATGAGTGGGTGAATATAACCTCCACATTAG
TAACCATATTAGGCCATCCCTGACCCATAGGCAGTGCTTAGTTAG


invisible?    
Gene introns: 0  

>11539 171 1017     15q26.2    chr15:98174171-98174001 BLAT!
AAAAAAGCTCAACATTACTACTCATTAGAGAAATCCAAATCAAAACCACAATGAGATACC
ACCACATGCCAGTCAGAATGGCAATTATTAAAAAGTCAATAAACAACAGATGCTGGTGAG
ATTGTGGAGAAAAAGGAACACTTTTACACTGTTGGTGGGAATGTAAATTAG


invisible?    
Gene introns: 0  

>29874 198 1016     3q22.3    chr3:138060536-138060339 BLAT!
TACTCAGGATACAGAAACCACACAATAATTTGGACAAGGATATTTTAATATAAAAAAATA
CTATGTGTAAGAGGGGATTACCTAGTAAAGGGAAAAGAAAACTCTAAAGAATACAATTAC
AGCAGATATAAGGGGCAGCCTCTAGGGCTGAGGCAGAGCACCCAAGGAAGGAAGAAACCT
GGATGAGGTCCTCATCTT


invisible?    
Gene introns: 0  

>10995 181 1012     1p31.1    chr1:73045327-73045147 BLAT!
AACAAACAAATTATTGCTATTAAATGAATCTTTGGAGTATACAAATGGAATTAGATTTTT
TAAACCATGTATACAATTATTATTATAGCATCATATCATTATTATCATTATATCTTTTTA
TCTGATTTTATAGACTACTTTATTCTACATTTTAGTATCTTTCAAAAATATATTCCAAAT
G


invisible?    
Gene introns: 0  

>15051 213 1011     4q13.1    chr4:63762313-63762525 BLAT!
ATTTTGAAACATTTCCCATCATACCATTTTTCAAATAGTTGATGCCCTGAGCTTCTCTAG
AGATGGACTTGCCTTAATCACCCTGGCCTTCCAAGCCCCTGTGTTGTTCCCCTAGAACAA
CAAATGAAGCATTTATTGTCTGGCACAAAAGGGACATTAGGACCCTGTTTTGGTGATCTG
GTGCTGGTGACGGTGGTGGCCTGCTTGGAGCAA


invisible?    
Gene introns: 0  

>21309 177 1010     6q14.1    chr6:77665689-77665513 BLAT!
ACAGTCATTAGGAAAAGGGGAAGGATTATGTCTATTTACAGCTAAAAAGTCAAGCTGTTG
GAGAACCTGAACAGTGGTATGAGTCTTAAAAGAAGAGTAGGGTAGTAGAATGATCACCAA
ACATGACCTGAAGAAACAGAAGAATAAACTCTTGAAGGTGTATGCTGAAAATAATGA


invisible?    
Gene introns: 0  

>16563 157 1009     16p13.2    chr16:9692319-9692163 BLAT!
CACTATTCAGAAAAAAATCCCTCTGCCAAGTGCGTCCCATTAAGGCTTCCTTTGTGTAGG
CCTGAATAATGGGCTGTGATAGCCTAGGCTGGTGAAAGGGAACAAAATTTCTATGAGAAG
TGCAAGACGACGATGTTTCTCTGAGATGGCCTTTGTT


invisible?    
Gene introns: 0  

>16150 181 1008     20q13.2    chr20:52382675-52382495 BLAT!
CCTGTAATCCCAGCACTTTGGGAGGCCAAGACGGGCAGATCACTTGAGATCAGAGTTCGA
GACCAGCCTGGCCAACATGGTGAAACCTGTCTCTGCTAAAAATACAAAAATTAGCTGGGT
ATGGTGGTGAGAACCTGTAATCCCAGCTGCTCGGGAGGCTGATGCAGGAGAATCACTTGA
G


invisible?    
Gene introns: 0  

>25935 178 1008     2q36.1    chr2:223032469-223032646 BLAT!
CAGGGTCTTATAGAATGTAATGTAATCATGGATGACGTTCCCCTGCCTTTGCTATGTTCT
ATTAGTGAGAAGCAAGTCATAAGTCCTGCCCACACTCAAAAGGAGAGCATTATATGAAGG
CATGAATACGAGGAGGCAGGGCTCATAGAGGACATCCTAAGAGTGTCCCCACGGTCCC


invisible?    
Gene introns: 0  

>6752 246 1006     4q22.1    chr4:91432377-91432132 BLAT!
AGGATGGTCTCAATCTCCTGACCTCATGATCTGCCTGCCGTGGCCTCCCAAAGTGGTGAG
ATTACAGGCATGAGCCACTGCACCCAGACTGATTTCTAGCTTCATCTTACTCTATCTCTC
AGTAACATTTGAGTTGGTTGATTACTCCCTTGTGGTAGAAACACTTTCCTGCTAACAGTT
TCCAATTCCATCTCATTGGCAACTCCCTTCCAGTCTCTTTGCTGGTTTTTCCTCATCTCC
CTAATC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>20590 211 1006     20p11.22    chr20:22289632-22289422 BLAT!
CACTAGAATCTTCATTTTACAGATTGGGAAGAAATGCTGATGCTATCTAGGAAACTACAG
TCAATGCAGTTCCATTCAAAATTATCACAGAACTTAAAAAGCATGAAGATTTACTTAAAA
AATATCTATACACACACTTGTAGGAAAAATGACCAAATCAGAAAATAAGACAAATTGTCT
AAAGCTAAAGTAACTAAGATAATGTTGTATT


invisible?    
Gene introns: 0  

>20284 211 1005     13q14.2    chr13:47840305-47840481 BLAT!
TTAGCCAGGATGGTCTCGATCTCCTGACCTTGCCCCGCGCCCGGCCGACATCACATTTTA
CTTCTGTCCATCAGCTCCTCAGTTTAGGAAAATCTTATCTTCCTAACAAATAGAAAACTC
TTGTAGCTCAAATAAGAGGAAAAGATGAGGCCTAATGTTTAAAGTCCTGATGGATTCAAA
GCCCTGATGGAGTCTCTCCACTCCTCATACC


invisible?    
Gene introns: 0  

Shown 721-750 from 3142 sequences on 25 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs