Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 751-780 from 3142 sequences on 26 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>14686 188 1003     1q23.1    chr1:158710720-158710907 BLAT!
AAATATGATTTACTTAATTATAAAGTAATAAATATGATTATTGTTTAGGCCAGTATTCTC
TTTTGATTTGGAGAAAACTCCAAATCAAAACTCCACTACTTGGAGTTACAAAGTGAAGAA
AATATTCCATTATAATCTGTGAATGATAGAAACATAGGTAAATCTATAGCAGACATCCCC
TGTCAGAT


invisible?    
Gene introns: 0  

>28497 201 1002     14q32.2    chr14:97178801-97178601 BLAT!
CTACTGGTCTTTCATTACTTCACACCTGGAAGGGTGTAGGTTCCCTTCAGGGATGGGGGT
GTCCGAGGAAGACCCACACAGGGACCAAAAACCCCCTCCTCACACAGACCTCCTGGCTAC
ACTCAGAAAGGTATCTGTCCTGCAACTGGAGACCGGCTCCGTTCCAGACCCAAGTTCCTG
ACTTGCAGAAAGGGTGAACTT


invisible?    
Gene introns: 0  

>32871 213 1002     5q21.3    chr5:106660548-106660760 BLAT!
GGAAGTTCCCATTGAAATGCAAATGAAATATAAACGCTTCTGGAAAAAGAAGCATATTTT
TGCAAGAATTAGCTGTTAGCCAGCTGGGAATGAGAGCAACCCTTGACCCAGAATGATCTT
TCCCTATTTGTGAATTCTGCCCTTTTTGCAGAGCTTGCCTAGCCAGCCTAATTCATCAAA
GCAACCCTGGCTATCCTTAGAATTATGGATGTC


invisible?    
Gene introns: 0  

>11541 194 998     4q13.1    chr4:59638440-59638633 BLAT!
TAAGTTAACATAAATCTGACAGTTTCATACTAACTTAACTTGTCCGACCTCTATGATCTC
ATATTCCATGATCCTCAATCATGAAACATTAAACTTAAACTCCTCTGTAGACATCATACT
CCCTATATCTCTGACTATTCCATAAACTTTGACACTTCTGGCCTGATTTTCCCTTCACTT
GAAATGCATTACCC


invisible?    
Gene introns: 0  

>33070 155 998     5q11.2    chr5:56614218-56614366 BLAT!
GCTTGAAAAGCAGCACAGATGCAGGAGGAAAAGTGATTGGCGCATAGACTGTCGCCACCA
GGGCCATGTCAGCAGTCAGGAATCTCTGCAATTTATGTTTGTCCGCTGCAGTGTGCTGAG
AGAATAAAGGTGAGGCTCGGAAGCGCCTGAATCCA


invisible?    
Gene introns: 0  

>8195 199 997     4q22.1    chr4:92497939-92498137 BLAT!
ACATCAGTGCTCAAAAAGTTTTGGATTTTGAGCATTTTGGATTTTAAATTTTTGGATTAG
GAATACTTAACCTATATTTTCAGCACACAAAGGTAACTATGTGAGGTGATGGATATAATC
ATTGATTGCATTGTGGCAATCATTTCATAGTGTGCATGTATATCAAAACATCACATTGTA
TACCTCATATATATTTAAT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>18831 201 997     1p22.1    chr1:93829176-93829376 BLAT!
CTCTAAGTTTAGGGCTCACCTGCATAAAGCAGGGATAATCCCCCTATCTCAAGATCCTTA
ATTTAATCACATGTGCAGAATCTCTTTTGCCATATAAGTGACATTCACAGGTTCCAGGGA
TTCATACGCTGGCTATCTTTGGAGGCCGTTATTCAACCTGCCAAAGTGAGATCCATTCTT
ATTGTTGCATGTATTTGTAGT


invisible?    
Gene introns: 0  

>24889 189 996     13q32.3    chr13:101641805-101641993 BLAT!
TTATAGGGAAATAAATTAGATGTCCTGACGTCTGCAGAATGTCCTCTAGACAGTGTCCTC
ATTATGCTGCCCTTGGTTCTTCCAGTTCATCAAATCTCATTTAGCTGTGCACCAATTAGA
CTGCCTTTGGCTGGAAGTGACATAAAGCTGAAAAATAGTGGATTATATAAGCCAATAGCT
TATTTTTCT


invisible?    
Gene introns: 0  

>17770 250 992     3p11.1    chr3:88530859-88530610 BLAT!
CTTTGAAGGAAAAACTTGAGGGTTGCAGTTTCCTCAAAAAAAGCATAGCTGCCAACCAAT
CAGCTTATTGAGAAGGGAATGATTAGAAAAGAGCTGAACATGTCATATAGGAAATTTTGC
TAAAGGCTGGTTATGGTATAAGGCTTAGAGGAAGAATTTCAGTATTTGGGTAGGAGTTAA
GATGTAGGGCTAAAAATGGATAAGCGTGCTGGCCAAGGGTGATGATTAAAGTCAATGACT
TTTCTCCACT


invisible?    
Gene introns: 0  

>20711 189 989     21q21.3    chr21:29400062-29400250 BLAT!
CCAATGGTTTGGCTGGATGGTCAGGCACTTGGAAGAAGCATAATTGGAAAATTAATGACA
AGGGAATTTGGGGAAAAGGTATGTGGATATACCTCTTGGAGTGGCCAAAAACTGTGAAGA
TATTTGTATCCAAAGTGAGTGCTCACCAACGTGTCATCTCAGCAGAAGAGAATTTTAATA
ATCGATTGG


invisible?    
Gene introns: 0  

>2287 185 988     13q14.2    chr13:48626792-48626608 BLAT!
AAACATTTTGTGGACAAGTTGAGCCCTTCTTCATACTGTCTTAAAGCTGCTTCCAACTCC
CTCAAGGCAGTTCATGGCTCCTACTTGACAGACTTCCACCTGTGGTCTGGTTTACCTCTC
TTGGGGTTGCAAGAATATCTTACCTAAATAGTCACTTTCTCTGCATCCCAAGTATCTTGT
TGATT


invisible?    
Gene introns: 0  

>2997 218 988     14q31.1    chr14:83515349-83515566 BLAT!
ATTTAACATTTATTTCCTCTGTGGCGATGGTGATGTCATAGTGAGGTAGGGGACCAGTAG
GACTTAACTCCCGGACCAGATTGAAAACTGGCTAAAACTGACAAGGGGCCCTGAAAGCAA
CGCCTGCTTCTTGTTGCTGCCCATCAGCATAAGACCTTCCCACCAGCGCCGCAACAGTTG
ACAAATTCCATGGCAACACCCAGAAGTTACCGGCCATT


invisible?    
Gene introns: 0  

>13271 200 988     5p14.1    chr5:28862299-28862498 BLAT!
CCAGAAGGCCCTGTAAAGATCTTATTCTGAAATTTCAGAAATTAGTTTCATCAGCTTTCA
GAATGAACCATAGACACTGGTGCCATGTGAAATCACTTTTGTCAATATGTAATTGAAATG
TAAACACCCTCCTCTAGTAAGGAGCTTTGTGTCAAGCTCATGGAGGGCTTTATAAACATT
GTAGCTCTCACTGTAGTGCT


invisible?    
Gene introns: 0  

>18341 179 987     2q37.3    chr2:238471860-238472038 BLAT!
AGCATGGCCCCTGCGCGGAAGTTACAGAATGAGGAAGACATGGTGTGCACACGACAAATG
CAGGTAGGACAGTCAGGCAGGTGAATGAACGAGGACCGAGAAGATCGCAAAGATACAAAG
CCGCAGTGCTGGGCTTTGGTGACTGTCCCTGCTCACCTTTCCCTTGAATGTGAATGCGG


invisible?    
Gene introns: 0  

>24451 218 987     1q41    chr1:218621760-218621543 BLAT!
GCACAACAGGGTGGATACTGAGAACAAGGAGAGATGTTTTCCCATCACATCATTTCTACA
ACTAGCACTTTGGCTTTTAAAGACTCCTGTTGAAAGACAATGGCACAGTGAGACTCCTCA
ACTGAATCTTTTGCTTGAAGTTAAGCTCAGTTGACCAATTTGTTTTGTTTTTCTCTCTAC
ACTTGCTGTAATGGTATATACAGGACATCAAACTCGAC


invisible?    
Gene introns: 0  

>33050 172 987     2q36.1    chr2:222626051-222626222 BLAT!
TTATTCTTCTAAATTGAAGTATGCTCAGTGAAGTCTTTGTAGAATGATTCAGGGTAAGGC
ATAATTGACCAAGCAATTGAAGAATAGCATATCTATGCTTTTGGTATATCTCTGTTGGTA
ACAAAAATTGCTTAGCTTGTATTTCTTTTCCTAATCCTTTTTCTCAAAATTA


invisible?    
Gene introns: 0  

>33107 196 987     9q32    chr9:117609799-117609640 BLAT!
TTGAAATCTTTTCCAATGCCAGCGGCCCGAAGACGAGCACTATCAAAATACGCAGCAAAC
ATATCATCAGATTCTGTAAACATATCAGGTGCCAACAACTTCTTCTGAGATGAACCATTA
TTCTGTTCAACTGTCATTAGATTATGCTTGGCTTTCACTGAGGCCTCAAATGTATCAACA
TTTTCCCGTTCATACT


invisible?    
Gene introns: 0  

>2047 207 986     5q21.3    chr5:105354444-105354238 BLAT!
TCTAACCTTTCCTAATACTATGCAAATTCATCTTATATTTAATAACAATAGGATATAGGC
CAGGTGCTGTGGCTCATGCCTGTAATTCTAGCACTTTGGGAGGCTGAGGCAGGTGGATTG
CCTGAGCTCAGGAGTTTGAGACCAGCCTGGGCAATACGGTGAAACCTCGTCTCTACTAAA
ATACAAAAAATTAGCCAGGCATGGTGG


invisible?    
Gene introns: 0  

>12983 176 986     4q13.1    chr4:61454448-61454623 BLAT!
CATACATACACACAGGCATGCAAGCACATGTCCACAGTCTCACTCTATGATTAGCTAAAG
GCATAATTTCAGCAGCTGTTGTAAAAAGATTTGAAATTTTGTTATGAATTCCAGGCAGTC
AGAGGCCTATATGTTATGTTTGAATGGTAGAGAAAAGTCCCATGTTTTCTAGTTTG


invisible?    
Gene introns: 0  

>26743 267 985     12q21.2    chr12:78018436-78018702 BLAT!
GAGAGAGAGAGAGAAGAATGACTCCAAAGTTTATACATTTTCTTCAATTTATGGGATGTT
CATTTGAGAAAGTAACATTTATCCCAAAATTAAAATTGACATTAACCATCAGATTTAACC
TCTTCGAGCCCTTTCAAATACTGTAGTATAATTCAAGGCAGCCATCCCTAATTCTTAGTA
TTTCAGTGGCTTATTTTAGATTGTATATTTTTCCAGCCTTTGATTTTGCCTTCCATAGGT
TTATAGTAAAAAAGTCAACACATACAG


invisible?    
Gene introns: 0  

>237 169 983     2q37.3    chr2:238471876-238472044 BLAT!
GGAAGTTACAGAATGAGGAAGACATGGTGTGCACACGACAAATGCAGGTAGGACAGTCAG
GCAGGTGAATGAACGAGGACCGAGAAGATCGCAAAGATACAAAGCCGCAGTGCTGGGCTT
TGGTGACTGTCCCTGCTCACCTTTCCCTTGAATGTGAATGCGGTGATTT


invisible?    
Gene introns: 0  

>3617 240 982     2q33.3    chr2:206372417-206372656 BLAT!
CGACAACTTCGAGTTCTAATAATGATATAAACTTTCTTCATCTTCTTAGATTTCCAGGGA
AAGAGAAAGAAAAGCCTTCCCTTTGTGTATTCTCCTGTTTATCGTTAGAAAGAATAGATC
TATTATCAAACTTAAATTTGCTGCCATTATTTGTTATGTAAAAGGAGAAAGAAAATTCAC
TTTGTCTATTGGTTCAGCATCTTTGAACTATCCCAGGAACCCAGATGATGTCACTGAATT


invisible?    
Gene introns: PARD3B (205410515 - 206480537)  

>20758 238 982     2q36.1    chr2:222644618-222644855 BLAT!
TAGCGGCCTCCTTCCAAGGAATTTGTTAGTTAATAATGAAAGGAATTTATCTATTTGAAC
CACTCTATGATGGATTTGCTGTTGCTTGAGCCAAACACATTCCTAACTGATACATTGCCC
TGGCTAGTGCCTAGCAAAATGACTTTCAACCAGCAAGAGGGAGAGAAAACACAGGAGCTC
AGGCTTTAATAACCATCTCAATAGCCATCATTCTAAAATCTGCTTCTCCAGTCCCAGT


invisible?    
Gene introns: 0  

>8822 222 981     9q22.31    chr9:94474456-94474270 BLAT!
ACTGCTGGTGAAGAGCGTAGGTGCTCCATAAATAATTGTCCCCACACACATACACAGATA
CTCATACACATACACCACACACACAATTTCACACACACCACACATACCACACACACACCC
ATACACATACACCACACACACACCCCACACACATTCCACACATACCCATACACATACACA
CCACACATACACATACACCACACACACCCACACCCACACACA


invisible?    
Gene introns: 0  

>13969 231 981     9p22.3    chr9:14921557-14921749 BLAT!
AAATCTGCTACAGAGAGTCCAATAGCCCAGGATGTGTAGCCTTTGAGTTTGATCACCTCA
TAAGCACTCTCAACCACCTGCTTGTGAACCTCTTTCCACTGTTCCTTATCTTTATCAGTC
CCTAAATCTGGGTGCAGAGTCTTCAGAGAGACACCAGCAACATTCATTCCACTCCATACA
GGCACACTGGAATCTCCCTTCAATTTGTCTTCGATGACATCAACAAGAGCA


invisible?    
Gene introns: 0  

>28608 222 981     1q23.1    chr1:157029481-157029261 BLAT!
TGGACATTACATTATTAGTGCATCCTCTGATGGCACTGTAAAGATCTGGAATATGAAGAC
CACAGAATGTTCAAATACCTTTAAATCCCTGGGCAGCACCGCAGGGACAGATATTACCGT
CAACAGTGTGATTCTACTTCCTAAAAACCCTGAGCACTTTGTGGTGTGCAACAGATCAAA
CACGGTGGTCATCATGAACATGCAGGGGCAGATTGTCAGAAG


invisible?    
Gene introns: 0  

>11270 180 980     21q21.1    chr21:20810087-20809908 BLAT!
AATATACATAAGGACATCTCACATTCGACATATCAACAATGTAGCAGTGGTCTTTTAAAA
ATCGGAATGTGCAAATAAAAGATATTATGTAAAATAGAAGAAGAAAGGAGCTTGAAAGAA
TGCCCAAGAAAATCAATGTCTTAGGTTGATATGAGAGGTGCTCTAGGGGCTACTCCACAA


invisible?    
Gene introns: 0  

>13721 180 980     6q25.3    chr6:160761690-160761511 BLAT!
TGAGACCGAGAGTGCCTCTCCAACCTCTTGTGAGAAAGCCCACTCACATTCCTCAGTTCA
GCCCGGTCAGTGCCCAGGTTCCAGCCACACCCAAGCATGGCAACATGTTCCCCTCAGGGG
TTTCCTCAGAAACCAGGGGCTCCCCACTTAAGCTAGCAGCCACTGTCAAAGGCAGGCTGG


invisible?    
Gene introns: 0  

>22519 193 980     4q21.23    chr4:84298869-84299058 BLAT!
GGCAGGATTGCTCTTCAATGTTGACACAAAGCTTCTACTTTTACCATGATGTTTCACTGT
TCTGTTGCATGTTTTACAAGTGATCAACAATACACTTTTGGAGTCTTTGAACTTTTTCAC
CATTTTTGCTTCTTTAAAACTGAGTGTATAGTTTCTCGCTTCTCGATTAAGAAGTTTCTG
TATTTTGGGTGTC


invisible?    
Gene introns: 0  

>27414 166 976     11q14.1    chr11:81221356-81221521 BLAT!
AAGAAAGGGTTTGTTTTCTGTAATGGAACTTGAGGAAGGAGTAGAAATCTGGCTGAAAAC
AAAAATAGTTTTCTCCCTCCCTACAGGGGCATGAGTTTAAAGCTGTGCAGTGTGTGTGTG
TTTGGGAGTAGGCATCACAGGTTTTTAAGACTAGCATGGTCACATT


invisible?    
Gene introns: 0  

Shown 751-780 from 3142 sequences on 26 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs