Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 781-810 from 3142 sequences on 27 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4346 102 974     Xq27.3    chrX:143473220-143473169 BLAT!
AGCGTGGTCGCGGCCGAGGTCGGCCGAGGTACTCTCGTGGCAAAACTGCTGAATCGTCTC
AGCTATCCTTGAACTGTTCCTCTTCCATAGAAGTTGGGAATC


invisible?    
Gene introns: 0  

>8073 117 974     2q35    chr2:220728405-220728289 BLAT!
CAAATGGATGGATGGATAGACGGTTGGGCAGATGGACGAAAATAGGCACTGCCATGTTCC
AAATCATTAATTACTATTTTGAGATGTGAATCCCCAGCCTCCCCGGTGGGTTGTGTG


invisible?    
Gene introns: 0  

>27024 182 974     8q13.3    chr8:72036824-72036643 BLAT!
ATCCTAAACAAGCAAATTGTTTTAGCATTTCTGTTCCAAGCAATAACATTCAATGACTGC
ATGGAGATTATTTTCAATAGAGATTTTATGAGAAAACTATAACTGGAAATAAAAGAAATA
TTCTAGCCATAAACATGACGTATCTCTTATTGCACATGTTGATGATGACATTGAATGAGA
TC


invisible?    
Gene introns: 0  

>22682 218 973     9q21.31    chr9:83416327-83416544 BLAT!
GAGGACACAGTGAGATGGCAGTCACCTACAAGCCAAGATAACAGGCCTCAGAATAAAACC
TATCTTGCCAGCACCTTGATCTTGGTCTTTCAGCCTCCAGAACTGTGACAAATTTTTATG
GTTTAAGCTACCCAGTCTATGGTATTTTGTTATTGCAAAATGTAAGCTGAGAAATTACAT
ATATATCTTTCATCTTTGCTGCAAATTTGATGCCAAGC


invisible?    
Gene introns: 0  

>30058 183 972     3p13    chr3:70161160-70161342 BLAT!
ATGAATGAGAGAAAAGCTACATTATAGTTGATAATGTGAACTATTAATGAAAGATACGAA
TCTTCAGATTGAAGAATTACATTGACTCCGAAGCAGGGTAAGCAAAAATAATTAAACAAC
TAGAAATACCACAAATAAACTGTAGAACACCAAAGTGAAAACGTTAAAGACAGCTAGAGA
AAA


invisible?    
Gene introns: 0  

>30452 191 971     2p23.3    chr2:25329740-25329930 BLAT!
ACCACGCCCGGTCCTTTCCATTGTTTGTATGGAAGTTTGCAGCATTTTATTTGGATAAAA
GGTTTTGCTGCCAGGAAATCAAAAGAAAGGGAAGGAGAAAAAGGAAGAGAAAGCAAAATG
AATCAAGCTCATTGTAACCCCTCATTTTGTTGGATTTCTCAGTGTAGAGATGGGACGCCA
AGAAGCGAAAT


invisible?    
Gene introns: EFR3B (25264972 - 25382004)  

>14360 178 970     8p11.1    chr8:43827991-43828168 BLAT!
AGTTTTGAGACACTCTTCTTTTGGAATCTGCAAGTGGATATTTGGATAGATTTGAGGATT
TCGTTGGAAACGGGATTATATATCAAAAGTAGACAGCAGCATTCTCAGAAACTTCTTTGT
GATGTTTGCATCCAGCTCTCAGAGTTGAACATTCCCTTTCATAGAGTAGGTTTGAAAC


invisible?    
Gene introns: 0  

>24152 204 969     20p12.3    chr20:6865832-6865629 BLAT!
CCCGACCTAGTGTCTCCCATATTTGAACACTTCTTCCTTTCATGCTTGCCTCTTTGGAAT
ATTCGTTTATTTCATAAAACTTAAGGCTATTTTGACATCTTTTAAAATTGCATCAAACAA
CTTTACTTTCTCCTCAAGTTATGTTATGATTGTCTGTTGTTACTCAATGCAAAATAGTCA
TTTCCCATCAAGTTTCTTTTGTTT


invisible?    
Gene introns: 0  

>2200 137 968     18q21.32    chr18:57684538-57684400 BLAT!
AGACTCGTTCAGGAGACATCTGCAATGCCTGTGTCCTGCTTGTGAAAAGATGGAAGAAGT
TGCCAGCAGGATCAAAAAAAAACTGGAATCATGTGGTAGATGCAAGGGCTGGACCCAGTC
TAAAGACTACATTGAAA


invisible?    
Gene introns: 0  

>18804 227 968     5q12.1    chr5:62455246-62455418 BLAT!
CCTTTGTCCATTGAATTGTCTTTGCTACTTTGTCAAAGATCAGTTGACTATATTTGTTTG
GGTCTATTCCTAGGCCGTCTATTTTGTTCATGACCCATTTGTCTATTCTTTTACCCTACC
ACACTGTCTTGATTACTGTAGCTTTACAGTAAGTCTTGTAGTCAGTCCTATGAGTCAGTC
CTATGACCTTGTTCTTCTCTTTCAATATTGTGTTAGCCTCTCTGGGT


invisible?    
Gene introns: 0  

>12152 197 967     18q12.3    chr18:38330073-38330269 BLAT!
ATCTCACCCTCGCCCCACCTGGCAAGTGGAAAATCAAAGAAAATGTTGGTTGTTTATTAA
GACCAAGCTCTTAGAATGAAGTCAGGTTGCAAGGGTATCTCTTCCAGTTTTATTGGTTAT
CGACAGCGAAGTTTGCCTTCAGAAGGACACAAGTCTGGAGGAAACCCCAAACTTCCAAGT
CTCGGAAAGTGGCTAAA


invisible?    
Gene introns: 0  

>13940 263 966     6q27    chr6:166561873-166561611 BLAT!
CTGAGCTTGTGACAAAAGTGGGCATGAAGGGAGGAGAGAGGCAGGAGCTGGAGCTGTGGC
TCCTCACCCCAATGCAAAAATTACTTTGAATCTCAACATTTCCCCCAAAGAGAGAACCAT
TACCTATCATAGATCAAAGTTCAAGTTATGCAAGAGGGAGCGCCAGGTGGGTATTACTGG
CCAAGTCTCAGACTGGCTTTTTACTCCTTGGTCACTCAGATTTAGTAGAGATGATGCCAG
GTTCTGGTCAGGAGCTGGGCACT


invisible?    
Gene introns: 0  

>19049 193 962     1q25.3    chr1:184333610-184333802 BLAT!
CTCCTGGTGATGTAACTCCCACTCCGAGGCCAAAAGCCTGAGAACCCGGAGTGTTCTCAA
GGTCAAGGGAGGGACAGTGGGAGGTGGAGCTAGTGTAAGTCCCAGAGTCAGAAGGCCCCA
GAACCAAGAGCTGTGATGTCCAAGGGTGGGAGAAAATGGATGTCTCAGATCAAGGAGACA
GGGAGAGGCTGGG


invisible?    
Gene introns: 0  

>1220 203 961     4q22.1    chr4:91432381-91432179 BLAT!
GGCCAGGATGGTCTCAATCTCCTGACCTCATGATCTGCCTGCCGTGGCCTCCCAAAGTGG
TGAGATTACAGGCATGAGCCACTGCACCCAGACTGATTTCTAGCTTCATCTTACTCTATC
TCTCAGTAACATTTGAGTTGGTTGATTACTCCCTTGTGGTAGAAACACTTTCCTGCTAAC
AGTTTCCAATTCCATCTCATTGG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>157 128 960     17q22    chr17:56358741-56358614 BLAT!
GAGTTCAAGACCAGCCTGGCCAACATGGTGAAACCCTGTATCTACTAAAAATACAAAAAT
TAGCTTCTTGCCTAAGGAAAAATACAAAAATTACTTCTTGCCTAAGGAAATAATTGATGA
TGTGGCTA


invisible?    
Gene introns: 0  

>1994 196 960     Xp22.13    chrX:17532170-17532365 BLAT!
TCCCCTTTATAAAGCCATCGGATCTCATGAGACTTTTTCACTATCACGAGAACACCATGG
GAAAGACCTGCCTTCATGATTCAGTTACCTCCCACCAGGTCCCTCTTCCAACACATGAGA
ATTCAAGATGAGATTTAAGTGGGGACAAAGCCAAACCAAATCAGCATGTCTGTGAGGGTG
TTACCAAAGGAGATTA


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>19165 195 960     8q11.23    chr8:53676404-53676598 BLAT!
GCAACAGCTATTGGCCATACATAGACCATTGCAACAAGCGGAGGCCATCACCAGAAAGCA
GACCATCACAGTAAAAACTGCCACTCATTCAAGAGTGGGTGAAAGGCATTCTAGCTAAGC
CTACCTCCAGGGTGACACAGTCGCACCTATCTATAATAAAGGGGTGCCGTGTCAGGCCTG
TAAGTCCTTTAAGTC


invisible?    
Gene introns: 0  

>31280 167 960     4q13.2    chr4:66690404-66690570 BLAT!
AAAATGTAAATAGAAATTATTCAAAAAAGTGTAGGGAAAAGAAGGGATGTGATGTTGCTT
GGATGAATAATGCAAAAGCACAAAGAGAAATACAATTATAGAGTCCAGGAACCTGGTGCA
ACTTGGGCTTTTTCTGCCGAAGTCTGTGCTCCAAATCAGTTCTGATG


invisible?    
Gene introns: 0  

>14269 185 959     Xp11.21    chrX:57793322-57793147 BLAT!
GGATACTGAGTCGAGGAATGGTTTCCCCAGATAATGACATTCTTTACATCATTAGCAGTC
ACACCAAGTTTAAGAGCAATTTGAGCTTTAGCTCGGTTGTGATCCAAACGAGTCAAGCAA
CTGAAGTTCTCCTTGGGGATGGATGGAGCTGACTTGGAAGCAGTCAGGCAGTTGGTATTG
GCTGG


invisible?    
Gene introns: 0  

>26942 276 959     4q22.1    chr4:92497497-92497222 BLAT!
TTTTTTAGATTTTACATATAGATGATATTATGTAGTATTTGTCTTCTGTGTCTTACTTCA
CTTAGCATAATGCCCTCCAGGTAAACCTACATTGTTACAAATGACAAAATACCCTTCTTT
TTAAAGGCTGAATAAAGTTATATTATATAGATATTGATTTAGACATAGATAATTGACAGA
TAGATAGATGATTGATAGATAGATAGATCACATTTCTGTATCCATTCGTCCATCAGTGGA
CATTTAGGTTATTTCCATATCTTGTCTATTGTGAAT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>32140 221 959     10p15.1    chr10:3862615-3862395 BLAT!
CAAAGATCAGTGGCCCCCGCTCTAAAGATTAAAGGAGCATTCAAGTGTGCTTACATCATA
AACTCACTTACTTAACTCCTGTCACCTCTGAAAGCTCAAAACCATTTTTGTCCAACTCTC
TACTTCCCCCATAGTGGGTTGGACCACTGGTCACCATGGTGTTGTCCTTACAGATTTTGC
TCTGGCTGAGCCACGTTTTGAAGGTGACATCAGATAATGAT


invisible?    
Gene introns: 0  

>16009 206 957     Xp21.2    chrX:29574210-29574415 BLAT!
TGAGTTGTAATATGGGGAGGACTGGAAGGCACAGCTTAGAGCCCCATGGTGTCCAGTCAG
GGGAACATGGGGATAATGTGTCCATTCACTGACACTAGCGCTTTTCTCCAATATGGTTAA
CAGTCGAAATTTGATTAAAGCAAGTTAGGAAACTCCAGTAAGGCTAATTTTCTCTTGAAC
TATATATGGTGTCTGTTGGCAAGAAA


invisible?    
Gene introns: IL1RAPL1 (28605680 - 29974017)  

>1865 271 956     4q22.1    chr4:92497488-92497218 BLAT!
TTTTACATATAGATGATATTATGTAGTATTTGTCTTCTGTGTCTTACTTCACTTAGCATA
ATGCCCTCCAGGTAAACCTACATTGTTACAAATGACAAAATACCCTTCTTTTTAAAGGCT
GAATAAAGTTATATTATATAGATATTGATTTAGACATAGATAATTGACAGATAGATAGAT
GATTGATAGATAGATAGATCACATTTCTGTATCCATTCGTCCATCAGTGGACATTTAGGT
TATTTCCATATCTTGTCTATTGTGAATAATG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>9564 208 953     6q13    chr6:72295200-72295390 BLAT!
GGTACGCGGGGGAACCGGAAGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATTG
AACCGGGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGAC
CTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCTGCAGTCACAGCTGAGCATGAAAGCT
GCCTTGGAAGACACACTGGCAGAAACGG


invisible?    
Gene introns: 0  

>28037 215 953     16q22.2    chr16:72038287-72038473 BLAT!
TTAACGTTGTTCATCTTGCAGCCTTGAATGCTATTGGCCTTCACAAGGTGGGCACAGTCC
ATCAGCACTTCCTTTGGGATGTCTTCTATATTCTCTCCCTTATGTAATCGAAGGTATACA
TGAGCCGAAGAGAGTTTGTCCACATGAAACCAGATATCTTCAGGCCAGCCATGCTTGATC
AGATCTTCATTTTCATATTTATCTTTTCCCATGTA


invisible?    
Gene introns: 0  

>23941 217 952     12q21.33    chr12:89784847-89784630 BLAT!
ACAGTTTATTAGGATGTTTTTTCATGTGAACTGTGACCTCCATGAGGGCAGTGACTGGGG
TTTACTCATCAGTGTAGCCCCAGCACCAAGCCTAATGCCAGGCACAAGTAAACACATGGT
CATAGTGAGCAAATCAGTCAACAATAACTGCTGAGGGTTTACAGTGACAAGGAATGACTG
TAAGGTCATCAGGCATAGATCAGATGAGTTGAGTTTT


invisible?    
Gene introns: 0  

>32606 189 949     1p34.3    chr1:39149819-39150007 BLAT!
GAATTGATTTTTGTATATTGATTTCATATCCAGCAACCTTGCTAATGTCTCATTTTTTCT
TCTAGTAATTTATCTATAGTTTCTTTCGGGTTTTATACGTAGTCAATCATAGATCTGCAA
ATAATAACTTGTGTTTCTTTCCCTCTAATCTTTATATTTCATATTTTTAGGCATATATCT
TGGCATAAC


invisible?    
Gene introns: 0  

>26018 198 948     4q31.22    chr4:148055071-148055268 BLAT!
TTACCATATGAGGGATGACATTATGGGCTCAATAATATGGCACTTTGAGAAAAAAATGAA
AACAACCCAATTGTTCATATGGTTGTATGAGACTAGATAGTATCATGACAACAGTGCTTA
CCATATAACAGAAAGTGAAGAAAGTAAGATGTCGGTATAATGCTACAAGTTTAATCATGT
GTTTAAAGAAAATTCATA


invisible?    
Gene introns: 0  

>17203 223 947     2q33.2    chr2:204468299-204468077 BLAT!
TGCTGATGCGTTATCCAAGGAAATAGATGATACTAGTGAAAAGATTCAAATGGAAATTAA
TATGGATGTCGTGTAGGAACCTACCTTGGTGGAAAGGCTCAAAGCCTCAAAACTAAATAT
GCTCGAATTGCATGATTTCGTAAATCAATATAAAAGACACCACAAAAAGCAACGTGAAAG
AGACAGGTAAGTGAACACACTTAGGATAGGATGCAACGGGGGG


invisible?    
Gene introns: 0  

>3178 197 941     8q11.21    chr8:49347134-49346938 BLAT!
ATCAACCTTACTTAGACTGAGGGGCCCAAGGAACACCACAGGAGTTAAAGGGAGGTGAAG
GCAGAGGGGAGTCCAAACTGGGTAGAAGGTCTTTTACGCTCTCACAACCCTGGGGCAATG
CAGAGTGCAACAGTGGCCAGCACTGTTGGGGAAGACAGGGCCATTAGCATTAAGTTATTC
ACAGAAAAGCTGGATGG


invisible?    
Gene introns: 0  

Shown 781-810 from 3142 sequences on 27 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs