Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 811-840 from 3142 sequences on 28 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>11744 170 941     3p11.1    chr3:88368056-88367887 BLAT!
AGACCCAAATTTCCTGTGCAACCTGCTGAATGAGTCTGAAGTCATGGCTGACCAGCATCA
TACCACCCTCAAACTCATTGATGGCATCTGCCAGGGCGTCGATGGTCTCGATATCCAGGT
GATTGGTGGGTTCATCCAGGAAGAGCATGTGGGGGTTCTGCCAGGCCAGC


invisible?    
Gene introns: 0  

>8012 172 939     1q24.1    chr1:166533975-166533804 BLAT!
GGAGTGCAGTTTTTTTAAAAGGATGAAGCAAAGAAAATGTATGGACTCTACAGTATCGAC
AGGTATTCAGAAATGCCACTTACCTGTAAGTATCTCTGGGGACACTACTTTTCTCTGTAT
TCTATCTACTCTGCAAGGGTGTGTTTCACCATCCACCACTCAGCTGAACCAG


invisible?    
Gene introns: 0  

>18521 217 938     2q36.1    chr2:222153880-222153664 BLAT!
TTAGTGAAAGACTTCTGCCACAACAAAGACGGACTAAAAGAAAACAAACCAGCTTATTTC
TACTAAACGTATATATTTTTATATTTTCATGTGTGAGTTTTAGTTTGTTGTTGTTGTTAA
TAACAAAAACCCACACAGAGCAGGTTTAAGGTTCATAAAAGATTTTAGTATCTCTGGAAT
CTCATTTGCTTGAAGAAAAATTCCCCTTGATCCTGAT


invisible?    
Gene introns: 0  

>25927 133 934     7p14.2    chr7:36842078-36842210 BLAT!
TGGCTTGAAAGACATAGCCCAACCAACACAAAACAAGGATAAACAACCTTTAGATGTTAC
CCAGATTGGTTTTGTTCCTCTGCTAAAGAAGAACAATAACATTTTTGTTTCTGTTCCTCC
AATCTCAAACTCC


invisible?    
Gene introns: 0  

>32542 184 932     11p15.4    chr11:4162931-4162748 BLAT!
CCTCTACTGGCAATGAAGACTCATCAGAATTTAGAGATTCAATATTACCAGCTTCATCAG
GATCTTCCCATATGTCACCATTCCAATTTTCAGGATCCCATTCATTCCTAGTCAATATCC
TCACTTTAATAGCAAAGGCACCCTGCAAGGCTCAGAATTCAATTTGCATTGTAACTCAGG
CACT


invisible?    
Gene introns: 0  

>8461 225 931     18q12.2    chr18:35907130-35906906 BLAT!
GCTTGCTGACAGCCTATTGTGGGACCTTGTGATCATCTGAGTTAATACTTTAATTATCTA
TCCTATTAGTTTTGTCCCTCTAGAGAACCCTGATTAATACACATACTCATTGGTCCTTCC
AATCTCCTTTCAAAAGTCTGCAGAACTCTGGCCTCTGGAACTCTATCTGCCATAGACCCA
CATTTCAGACGCCACCTACCCCTCCATCTGAGACCTTGAGTTACC


invisible?    
Gene introns: 0  

>4933 159 928     22q12.3    chr22:35140502-35140344 BLAT!
CATAGCTTTTATTAGGTTTCCAGAGGGGTCTATGACCTAGAAGAAGGTTAAGACCACTGC
TTTGAAAACACTAGATCTTCAAAGCTAACCCTGCTCTGTCTTTGAAGCTTTGCCCACCAT
GGTGGCTTTGAAGCTGAAAAGGCCATTCTCAAAGGTTTT


invisible?    
Gene introns: 0  

>12777 300 927     20p12.2    chr20:12042744-12042445 BLAT!
CTGTGTTGCCCAGGCTGGTCTCAAACTCCTGGCCTCAAGCAATCCTCCTGCCTGGACCTC
TCAAATGTGCTGGGATTACAGGCGTGAGTCACCATACCCAGCCAGGACTTCAACATATCT
TTTGGGGGGACACAATTCAGCCATAACACCACCCCTGAACAATTATATCAGAGTTTCTAG
GGTGAAGCCCAGACATCAGTATTTTGTAAGTGCCCCAGATATTCTAATACACAGCTAGGG
TTAAGAACCACTAGCCTGGGAGAAGGTCTGCAGCAGCCACTGTCATCAAGGAAAGCCACT


invisible?    
Gene introns: 0  

>11338 192 926     4q13.3    chr4:74951821-74952012 BLAT!
GAAGCAATTTCAGCGTCAATTTTATTACTGGTCTCTGAAATAATACTTTTGGTTTGAGTA
TCCTTTTTTGTAAATTCTGTAGTTGTTTCCATAAGTTGCTTTTCTTGATCTGTAAACATA
TCTGTTACTCTGCTCCTTTCTAAGTTGATATCCAGTTTATTATCTGCTCTGATTCGACTG
GTTTCATGCATT


invisible?    
Gene introns: 0  

>13265 201 925     10q23.1    chr10:82823443-82823643 BLAT!
AATGTCTGCCAAATGAAACTGATTTTTAGACACCTGGCCTCCAGAGCTGTGAGAAAATAA
ATTGCTGTTTTTTGAAGCTACCAATTTCGTAGTGAGTTGTTATAGCAGCCCTATGAAGTC
AATACAGAGCTCAACATTTGCATTTGCATCAGGAATATCTGAAGGTCAGCAGTGGCCATT
GGCAGAAAGCCTGATGAGGCA


invisible?    
Gene introns: 0  

>19989 166 925     1p35.1    chr1:32993997-32994162 BLAT!
AAAACAAAAAAGTGCCCTTAGACTGCCAAACGGGATAGTTAAGAAAAAATCTACACGTAG
GCACATTACAATAAAATGTAAGAATAGCAAATACAAAATGTAAGAACGTCAAAGACGGCC
AGGCGTCGTGGCTCACGCCTGTAATCTCAACACTTTGGGAGGCCAA


invisible?    
Gene introns: 0  

>11980 177 924     4p15.33    chr4:11306399-11306569 BLAT!
GCGGGGGGAGTTGTCAGTTTTGGAGATACCTATGCAGCCTGCAGCCATTTCTCTTCAAAC
AGATCTAAATGAGTGGGTGAATATAACCTCCACATTAGTAACCATATTAGGCCATCCCTG
ACCCATAGGCAGTGCTTAGTTAGATTAGTAGAAAGGGTCATATTCTTTTCCTTTCAA


invisible?    
Gene introns: 0  

>1132 195 923     2p14    chr2:66470251-66470445 BLAT!
AGAAGTTCAAAACGCTTTACCAATTATTTGTTTGGAAGCAGACTATGATTTCTCATCCTC
TGCAGTGAATGCTGTTGTGGTAATAAGGAGGAGGAGGTTGACCATACTGTGTCTGTTTTT
CAATATTTTGGTAATGCTTCCTGATTCTCTTTTGGGGAATTGCCTTTCCCTTGTTTTAAG
TGAAGATGCTGTGTC


invisible?    
Gene introns: 0  

>1442 159 923     1p35.1    chr1:32994008-32994166 BLAT!
GTGCCCTTAGACTGCCAAACGGGATAGTTAAGAAAAAATCTACACGTAGGCACATTACAA
TAAAATGTAAGAATAGCAAATACAAAATGTAAGAACGTCAAAGACGGCCAGGCGTCGTGG
CTCACGCCTGTAATCTCAACACTTTGGGAGGCCAAGGCG


invisible?    
Gene introns: 0  

>16212 208 922     2p12    chr2:79208694-79208901 BLAT!
AGATATGATAAAGCCTCATATCAAAGCAGGTCTGGCTCCAGAGTTAGAGCTCATCTTGTG
ACATGGACTCTCAGCCCAGATAACGCCTGGCAATTAGTATATGAGAAATAAATCACAAGC
ATTTTGTTAGCCAAGCACACAGACCAAGTTTGTGACTTTGCCATCACTCTTGGACATTGT
GTTCTATACACAGAGGGCTTTAGGCATT


invisible?    
Gene introns: 0  

>1773 176 920     6q13    chr6:72295397-72295228 BLAT!
CGCGCCTCCGTTTCTGCCAGTGTGTCTTCCAAGGCAGCTTTCATGCTCAGCTGTGACTGC
AGCTCAATCTCAAGACCCTGAAGGGTGCGCCGCAGGTCAGTAACCTCGGACCTGCTCATC
TGGAGCTGCTCCGTGTGGCCAGCGACCTCCCGGTTCAATTCTTCAGTCCGGCTGGT


invisible?    
Gene introns: 0  

>5258 230 920     6q24.3    chr6:146692804-146693033 BLAT!
TCAATTGATTTGATTTTTAGATCCCGCAGATAAGTGGGAATATGTGATGCTTGTGTTTCT
GTGCCTGGCTTATTTTACTTAACATAATAATCTCAAGTTCCATCCATGTTGTTGCAAATG
ACTGGATCTCATTCTTTTTTATGGCTGTATAATACTCCATTGTGTATATGCATTACCTTT
TCTTTAAATTCACCTGTTGATGAACATTTAGGTTGCTTCCAAATCTTAGC


invisible?    
Gene introns: GRM1 (146348781 - 146758731)  

>5503 193 920     6q15    chr6:91138602-91138410 BLAT!
ATATAGCTGGAATGTGGCAAAACAAGATTGATACCCCATATGTTTGACTACAAAGGCTGT
GCTCTTAACATATTTTCTGGTGATGACACATGGCAGACACTCAAAAAATGCTTGCTTAAT
GCCAAACCAAAGAAGGCAACAGTGCTTTTAGAGCTTCCTTCCAGATTTGAAGCCACGCAA
GTGGCAGCCAAAA


invisible?    
Gene introns: 0  

>18764 221 920     13q34    chr13:111590540-111590760 BLAT!
GGGGGGCAGAGGTGAAGGCAGAGCCTGTTGAAGTTGTGGCCCCAAGAGGGAAGTCAGGGG
CTGCGCTCTCCAAAAAAAGCAAGGGCCAGGTCAAGGAGGAAGGTATCAACAAATCTGAAA
AGAGAATGAAATTAACTCTTAAAGGAGGAGCAGCTGTGGATCCTGATTCTGGACTGGAAC
ACTCTGCGCATGTCCTGGAGAAAGGTGGGAAGGTCTTCAGT


invisible?    
Gene introns: 0  

>11738 202 918     3q12.1    chr3:98378507-98378306 BLAT!
TGTGAAAGCAAGAAAAACCATTCTCTCGCTAGGCCACCATAATCAAGTCCTTCTTCTCCT
CTAAATATTACATATAAGCGCCTCCTCAAGTCATAGGGTTTTAATGCCATAATCTGTTGG
AAGGAATCTTCAAACAATGTCTGCCGGGACACATTGATCTTTACATGACTAGGTAGTGCA
TTAGACTGGCACAAATAACGGA


invisible?    
Gene introns: 0  

>10905 177 917     Yq11.221    chrY:19271749-19271925 BLAT!
AAACAAACAACAACAACAACAACAACAAAAATCATTTCAACAGACTGAACACAGAAGATA
AGGGAGTTCATCTGTCCTTTATTAAACCAGACATTTAAAAAATTTGCAAACAGGCCGTGC
ACACTGGCTCATGCCTGCAATCCCAGCAATTTGAGAGGCCAAGGCGGGAGGATCAGC


invisible?    
Gene introns: 0  

>29972 231 917     1q41    chr1:219463618-219463848 BLAT!
TTAGAGGCATTCGAACCAGAGGAACTCCATCTTGAGTGAGGGCTAGGAAAAATGAGGCTG
AGACTTTCTGGGCTGCATTCCCAGGACGTTAGTTATTCCTAGCCCCTCTACATGTTTAGG
TTTAAAAGAACAGATTGATAACATTTACTAAACAGACCCAGACTTCCAACATCTTGAGAA
GCATTTCTAATTTTGCTTTAAAAATAATAATATTGATTTTTACAAAATACA


invisible?    
Gene introns: 0  

>8393 144 916     3p22.1    chr3:40973195-40973080 BLAT!
AGCGTGGTCGCGGCCGAGGTCGGCCGAGGTACTTGTTCATCAGTGTCTGGGCATTGAAGA
GCTAGGCATTTATTGTAGTCTTCACAGTCTGGGACTATTTGTGCCTGTCCTTCCAGGCTT
TCCAGGTGTTTGAAGGAACTTGAG


invisible?    
Gene introns: 0  

>13568 145 916     9q22.32    chr9:98909108-98908964 BLAT!
TCCGGGAATCATAGCCTCTATCATAGTCTCTGCTGCCTCGGTCATCATAGCGATCCCGGC
CACCATATCGATCCATATCCCGGCGTGGGCCATCCCGATACCCATCCCGATACCCATCCC
GATACCGGTCTGAATCATAACGATC


invisible?    
Gene introns: 0  

>11794 259 915     3q13.31    chr3:114047812-114047554 BLAT!
AGTGAGGCTGTTTCTTCTCTAATGATCACATAATATCCAAATTATATCAACTTCATTATT
TCCCTCTTTCCTTTTCCTAACCCTTTCCCTTTATTTCTTGTTTCTCTTGAAGACTACTTC
AAATTACCTATTTGTCTTCATTACTGCCCCCAAAACTCTAATAATTGTGACCCCTAACTG
TTCATTTCTCTTCCTTTCTCCACCCCATTCTGAACATCCTTCTTTAAGTTTTATTTAATG
AAAGAACACTAAAGTGAGT


invisible?    
Gene introns: 0  

>32141 201 915     Xp22.13    chrX:17532390-17532190 BLAT!
TCTCCCAGTCTACTGACTCAAATGTTAATCTCCTTTGGTAACACCCTCACAGACATGCTG
ATTTGGTTTGGCTTTGTCCCCACTTAAATCTCATCTTGAATTCTCATGTGTTGGAAGAGG
GACCTGGTGGGAGGTAACTGAATCATGAAGGCAGGTCTTTCCCATGGTGTTCTCGTGATA
GTGAAAAAGTCTCATGAGATC


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>15991 315 914     5q13.1    chr5:67465972-67465658 BLAT!
TTTCAGCTGAAATCTCTAAGTGAGAATTCTCATTCCCAGCTGCTGGCTCCCTGGGAGCTC
TCCGTGGCCTCTGACCTCATTTCCATGGAGACAGAGGTGGGAAGGGTAAAAAATAAGTTA
AGGGGGAAACTTTTCTTAAGGCAGTATTTCCAAATCCCCACTCCTCTAACACTAATGACT
GTCCAAGTTAAAGCTGGCCACACATCACTATTTGAAATCACTTTCAGTTTTTCAAGGGTG
AATGGCTAAAAATGAGGCATTTGATTGTAAAGATACATTTGCAGAAATAAAAGAAAATAC
CTGACGTATTTGATA


invisible?    
Gene introns: 0  

>29256 255 914     2p24.2    chr2:19168940-19169166 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGACTTTTAAAAAGTCTGTAGCTTCTCCAGGCGT
TGAATCATCTGGCTTGGGGCCAGACACTAGAGGGTGCTTTAGAAATATTATTTGATGATG
AACTCGGATGTTAGCCACTTGCTTTTCAGAATTCATTCCTGTAAATCATGGCTTTGAAAA
CTTGTCAGTATTTTGCTTTTTCTTTTGTGGATTTCTTCAAAGGGAGAAGGAATGTCTGAA
AAGTAAACATTCAAC


invisible?    
Gene introns: 0  

>30441 161 914     6q14.1    chr6:78110498-78110338 BLAT!
TTGCTGCTTGGAAGCCAAAACACAATACATGAGATGTGGTGAAAAGAAATCAGCTTTATT
AATCAAATTCTAGCAGGTGAGAGATGGCCAGGCTCACTCCTCAAATAAACCATTTCCAGT
TTTGAGCTGAAGGCAGGGATTTAAAAAGGGGAACCTTGGTA


invisible?    
Gene introns: 0  

>6070 235 911     17q24.2    chr17:66088051-66088285 BLAT!
CACAGCTAGATTCCCCGCTGTCTTCCCCTCTAAAAATAAATACATAAATAAATTAGTGTG
GTGGCATGCACCTGTAATCCTAGCTACTAGGAAGCCTGAGGCAGGGAGGATGGTTTGAAC
CCAGGAGATCGAGGCTGCAGTGAGCTATGATTATGCAATTGCACCCCAGCCTTGGCAATA
GAGAAAGACCCCACTCTCTATTTTTTTAAAAAAAGGCTGTAAATTGGCCGGGCGT


invisible?    
Gene introns: 0  

Shown 811-840 from 3142 sequences on 28 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs