Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 841-870 from 3142 sequences on 29 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>7815 147 911     12q12    chr12:38661415-38661561 BLAT!
AATGCACAAACTAATTATTGCAAAGAGTTTAATGGAGAAAGTGTTCATAAACATGTGTTC
AGGTTTGTAGGAATCCATTAAAGGATCGTGAAATATCCTGAGACAAGTGGCATCATTTGT
TAATACTGCTAGGACTGAGAAGTCCAG


invisible?    
Gene introns: 0  

>12135 206 911     15q21.2    chr15:51273527-51273732 BLAT!
ATTTCTCTGTTGGGCTTTGGACTTATTTGAGACCACTTACCCCTTTCTTCTGGCCTATTC
CTCCCTTTTGGAATGGGAATATCTACCTTATGCCTGCTCCACTATTGTATTTTGGAAGCA
CATAACTTGTTAATTTCACAGCCCCACAGCTGGAGAGAAATTTGCTTTTAGTCTCACCCA
TATCTGATTTAGATGTCTCTGGATTT


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>22412 200 911     11q22.2    chr11:102753831-102754030 BLAT!
TGTCTTCCCAGGCCCAGATCTGGTATGGTAACTCCCATGAAGCCTTATCTCATGGCCCAC
TCCTTCACTTGAAGCCCCATTCAAGTTGCTAGCAGGCTCTGTGCTTCTTGCCTCAGCATT
TGTGACCCTAAACAGATATTCACATTCTGACCTTTTTCCCAGAGCCTAAATCCACTGAAC
TGAATTTAGTGGGTCTGTTT


invisible?    
Gene introns: 0  

>7409 140 905     14q22.1    chr14:51441199-51441304 BLAT!
ATGCTTGGTTATAATTTTTCATCTTTCCCTTGCGGTACTATTCCACTCTGTGAGGTTATA
ACTCAGACCATATATTTGTAGGTAATGTTTTTCCTTTAATCAAGAAACAAAGTGTTTTTT
TAGTGGCTAACAACAATGTT


invisible?    
Gene introns: 0  

>10579 210 905     5p15.2    chr5:10664426-10664635 BLAT!
AAAATGAGGTAAACTGCTCTGCAGTGAGTTCTTCTACTCAGAAGGCAGTAGGTGATCATG
CTGGAAGTCACATGATCAAGGCTGCATCTCCCATCATCCCTCTGGGCAGTGATATGGGAT
AGTGGGTCTCTTTGAGGACTTTCAAGCCTGAGGGGGGGATGGACAACATATGATTCATTG
CTGGCTTGGGTCCATGTCTGTGGTCAGCTT


invisible?    
Gene introns: 0  

>24581 192 905     12q21.31    chr12:80956368-80956559 BLAT!
TTGAAATGAAAATTCAACATATCAAAATTTGTGAGACTCAGTGAAAAGAAAGAAATTTGT
AGCACTAAGTGAATATATTTAAAAAGAGAAAATAGACCAATAATCTAAATTCCCTCCACA
AAAGAAAGCCTAGAGATAGAAAAGGCAGAGAATCCAAACCATGCAGAAGGCAGGGAATAA
TAAAATGCAGAA


invisible?    
Gene introns: PTPRQ (80838125 - 81073968)  

>30464 143 905     8p21.1    chr8:27726149-27726292 BLAT!
AACAAAAAAAAAGGCCAGGCGCAGTGGCTCACACCTGTCATCCCAGCAGTTTGGGAGGCT
GAGGCGGGCAGATCACCTGATGCCAGGAGTTCGAGACTAGCCTTGCCAACATGGTGAAAC
CCCATCTCTACTAAAAATACAAA


invisible?    
Gene introns: 0  

>19857 197 903     18q12.2    chr18:35365248-35365052 BLAT!
TGAGGGCTGAGAATTTTTCAAAATTAATGATCGTTATGACACGAAACAGGGAAAAAAATG
AAACAAACTAAGCATGTCATATTCAAACAACTTGAAACCAAAGACAAAGAAAAATCTTGA
GAAGCCCGAGAAAAATGATACCTTACTTATGGAAAAATAAAGATAAGAATTATAGTAAGT
TTCTCATCAGAAACCAT


invisible?    
Gene introns: 0  

>13833 187 902     18q12.3    chr18:38330042-38329852 BLAT!
AGATCTGTGTTGAGAGGTGACTGGCCTTTATGTCAGGGGGTTGGGACACAAGATGCACAA
CCACGTTACACTAATTGTGACCAGCTGTATGAGATGTTCTTAGTCAAAATCTCCCCAACT
CTGCAAAAAAATACTCCTGCTCTCTATCCCTACTCTTACCACAACGCTATCCCTTGTGCC
TATTTTT


invisible?    
Gene introns: 0  

>14056 193 902     12q12    chr12:38661111-38660993 BLAT!
TGAATATCTTTTTAAAAATTATACTTTAAGTTCTAGGATACATGTGCAGAACGTGCAGGT
TTGTTATATAGGTATACCGTGCTATGGGGGTTTGCTGCACCCATCAACCCATCATCTACT
CACTGTCTCTTGATCATCAAATTCACTCTAGCCCCAGGGCCTTTGCATGTGATATGTGCT
TTCTGTGTATTTG


invisible?    
Gene introns: 0  

>28818 245 900     14q22.1    chr14:52755756-52755935 BLAT!
GGGAGAGAAGGTTGTTTTGCAAAAACACTTGTAGAGCATGTTGGTATGAAGAACCTGAAG
TCCTGGGCTAGTGTAAATCGAGGTGCCATTATTCTTTCTAGCCTCCTCCAGAGTTGTGAC
CTGGAAGTTGCAAACAAAGTCAAAGCTGCACTGAAAAGCTTGATTCCTACATTGGAAAAA
ACCAAAAGCACCAGCAAAGGAATAGAAATTCTACTTGAAAAACTGAGCACATAGGTGGAA
AGAGT


invisible?    
Gene introns: 0  

>12371 193 899     2q22.1    chr2:142149162-142149354 BLAT!
AGCCATTGAACAGTTTTATACAAAAAAAAATATGAGATGATCAGATTTGTTTTGAAAAGA
TGACTGTCTACAGCATCAAAAATCAGGATTAGAGGAAAGAGAAACTAGATGAAAGGAGAA
AGGCTGCTGCAGTTGTTGGGAAAGCAGATAAAGGTAGTCTGGGATCGAACAAGGGAATAG
AAGTAGAAGACAA


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>13841 172 899     3p13    chr3:72322252-72322081 BLAT!
AACTGTTTTAAAGCATACAGGTCAGTGGCATTGACTGCATTCACCTTGTTGAGAAACCAT
CACCTCTGTCTATTTCCAGAACATTTCCAATTACCCCAAAAGTCAGTCTCTATGAAGCAG
TCACCCCCTTCCTCCATCCCTCTACTCTTCGACCCTGGCAACTGCTAATCTG


invisible?    
Gene introns: 0  

>4118 217 895     6q27    chr6:167480227-167480443 BLAT!
TGCACGGATGTTTATAGCAGCATTATTCATAATAGCCAAAGGTGGACACAGCCCAAATGT
TTATAAATGAAGCATGAAAAAAGTGGTATATCCATTATTTGGCCAGAAAAAAGAATAAGT
TACTGATACATGCTACAACTTGGATGGAACTCAAAGCCCACATGTATATATCCATTCCTA
TGAGAGTCCAGAATAGGTAAATCTATAGAGACAGGAA


invisible?    
Gene introns: 0  

>9824 169 895     7p13    chr7:43393382-43393210 BLAT!
GTGGGTTGAGGCAGGGACAAGTCTCCTCCCAGGGAACCCAAAATGATGTGGAAGCTGGTT
GTCTACCTCCATTTCACTTTTTCCAGTGTATAAATCATGAGTTGGGGAAAAATTTTCCAT
GCACTTGGTGCCAGGTAGATTGAGGGGAGGGGCATTGTGGATATGGAAG


invisible?    
Gene introns: HECW1 (43152197 - 43602938)  

>10075 232 895     Yq11.223    chrY:22582578-22582809 BLAT!
AGACAATAAATGCTGTCAGGATTGTGTTTATTATTCTTCAAGGTAGCAGCTTCCCTTTTA
GTCCAAAGTATTTCTAGACATATCATCTTGTAACTCAGTCCTGTATAGATGGCCTCACAA
ATCTGACTGCTGGCCTATTCTGTTGTGGCTAAGCTGGTATTCAAGATACAAAACGAAGTC
TTCCTCCACTCTTCCCATTCTTTTATTCTAGTGGAAGAAAAGGATCTCTTTT


invisible?    
Gene introns: 0  

>10757 178 895     20p12.1    chr20:13369340-13369163 BLAT!
TTTGGCTTCAAAAGCTTTTGAAGACCTGTTACCTGTTGGCAGAGATTTTTCAGGAACTGG
ATTGGATCACATAAAACTATCAGGACACTTTGGAGTCTGAAAATCGTCTGACCAGTTTCA
CCAGGAATGCCACTTCTTTCATCTCCTTTTGCCCTTTTTCCATTTATATTTAAACATT


invisible?    
Gene introns: 0  

>17752 145 894     7q32.3    chr7:131444555-131444699 BLAT!
AATGGTAAGAAGATTCTGGCAGTTCCCTGGGCTTTTATTATAAAAATCCAAAAATGGCCT
CATGGGCTCAAACTCTAGTAAAGGATTTAAGGGTCATTGTATTAGAGACTGCGGTCTTCC
TTCCCTTGCTTGCTATCTCACTTTC


invisible?    
Gene introns: 0  

>7173 180 892     2q36.1    chr2:222469649-222469828 BLAT!
AAATTCAGAAAATTTACTTTCAGAGTTGACATCTGATCAAACTTTACCTGAGTTATAAGT
TTGTCTTCCCCTAGATGGCTACGTGAAATCATAGAGTATTAATTTACTATTCCCCCTCTT
TCTGCAGAAATGAGCTTGCATTTCTGATCAGCACCTGTTCTCACAAGTTGTCTCTCTGTT


invisible?    
Gene introns: 0  

>25456 195 891     6p22.3    chr6:21585691-21585502 BLAT!
AGACAGAGTCTCACTCTGTCACCCACGCTGGAGTGCCATGGCATGAGCTCATCTCCCTGC
AGCCTCCACCTCCTGGGTTCAAGTGATTCTCCTGCCTTAGCCTCCCGAGTAGCTGGGATT
ACAGGCACCCACTACCACGCCTGACTAATTTTTGTGTTTTTAGTGGAGACAGGATTTCAC
CATGTTGGCCAGGCT


invisible?    
Gene introns: 0  

>29018 185 891     3q22.2    chr3:135645037-135644863 BLAT!
TGGTTATAAATCATGTTTAGCATGGAAACAGTTAAACTGAAGCTTTCTTCTCCTTATAGG
TTGCCATCATTTTCTTGATCTCTGCAATAGCTTTCCCTGGATTCAGACCCTTAGGACAGG
TCCTTGTGCAGTTCATGATGGTGTGGCAGCGGTATAGAGAGAATGGGTCCTGCAGCTTGG
CCAGG


invisible?    
Gene introns: 0  

>13834 264 890     10q24.1    chr10:98749899-98749636 BLAT!
CGTTTTAAATACAATAATCTTTTTATTTTTCCCCTGAAAAGGATTTGAGAGCAAGCATGG
GGAATAGCACTTACTGCTAGGATATGAAGACCGCCTTACACAGATCAATTTTATACTTAA
AAAAAATTCCAGTATTTCAGTGGATATCAAGTCACAATAAGACATCAAAGTAATACTAAG
AATTCAAAATGATAATTGTTTCAAAACAACTAAAACGATCAGTGATTTGGGGCCACTGAC
AAAAATTTTTCACTGACAGGACAT


invisible?    
Gene introns: 0  

>27406 166 890     8q11.23    chr8:53676042-53675877 BLAT!
GTGCTATCTTATCAATGATAGCTCTGGGTGTGTTTTACATCTTACTCAACCAGGTAACTC
TCAGGACTTTGATGGCCTTGCCAGATCCCTAAAACTTTTTGGAGTTGACTTTCCATCCCC
TGTCTTCTAGGCTGGCCAAAGACAGTCTGCAGGGAAGCCTCCAGAG


invisible?    
Gene introns: 0  

>4499 123 889     17q22    chr17:56358735-56358614 BLAT!
AAGACCAGCCTGGCCAACATGGTGAAACCCTGTATCTACTAAAAATACAAAAATTAGCTT
CTTGCCTAAGGAAAAATACAAAAATTACTTCTTGCCTAAGGAAATAATTGATGATGTGGC
TAA


invisible?    
Gene introns: 0  

>8505 278 888     4q34.1    chr4:175455734-175456011 BLAT!
ATGCAAACATAGTTGGGATATGTGGCATTTCATAGGACACATTTGCAGAAAATGATGGTA
TTATGATCTGAGGGTGGAATTTTTGGTCCTCTGATGTCAAAATGCTCTCCGGCATTTACA
GAGGCCCAGCTGAAGAGTCAACCAGTTTGAACTGGTCAGGAGCTGTCCCACATTCCTGAA
AAATAACTGAAGTGACCATTACCATGGTGATTTATAAATGTTCAATTTATTATGCCGCTA
ATGAAGGTTAAGTTTCAGCGTTCAGTGGTGCAGCCTTC


invisible?    
Gene introns: 0  

>9892 160 887     9q13    chr9:67836067-67836226 BLAT!
TTGTCACTGCAGTGCTGCACATCACAGCCCTGGGATGAGCTCAAGGTTTTTGTTTCCTCA
CAAGCTTGGGGACAAAAGGGGTGAGGACCTTGGCAGTGGTAATGTGTGGAGGTCTATCAC
TTGTCTTTTGCAGCTCCACCATACAGAAATGCAGAGATGC


invisible?    
Gene introns: 0  

>25754 163 886     1q25.2    chr1:176231969-176232131 BLAT!
GGCAGCTCTGCCAGTCATGGAGTTGTTGTCATCACTAGCAATGGTGGGTGCTGAGCAAAC
TGATACTTTTGCCCTGGCAGGTGCACATAATGCATGGTGTCTTCACTGGTTGAGGTGGAT
GGGGTCCCCTTAGTGGTGGTAGATACTACATGTGCTGGTCTTT


invisible?    
Gene introns: 0  

>30307 213 886     4q32.3    chr4:165607729-165607941 BLAT!
CATCAAATTGATAGGCAAAGGGGCTGTGTGGCTTTGTTCAAGCTACCGAAGCCAAAAGCA
CCATCATTTATTTATCTGCAAAGCCAGGATAATAAGAATGTCTTCTTCATAGGGTAATTG
TAAGGGTTAAATGAGATAGTCTACATAAATGCTAAGCACAGTGCCTGGCCATAAATATGC
CCTGCTATTTTGACCTGTTATTTTGGTTTGATT


invisible?    
Gene introns: 0  

>21026 211 885     4q31.23    chr4:148529602-148529812 BLAT!
GCGTGTGTGTGTGTGTATGTATTCCCACCAGATATCCTGGGACTGGGATAATATACACTG
GATGGGCCTGCAATCCCAGTAGGTCCACTGTTACATGAATTGGAGCCACAAATTCATCTA
ACACCTGACATCCATAAGCCCTACTTTGGCAGATGATTGTAATGTTTTTGGTCTGTGGCA
TAAGTGTAAAATCAGAGCCAGTATGTGATAC


invisible?    
Gene introns: 0  

>12800 229 884     12q24.33    chr12:130754896-130754668 BLAT!
TGTTGAATGCTCTGGCCAACCACTGAGATGTGTGTGTGTGTGTGCGTGTGTGCATGTGTG
TGTGTTGTGTGAACAAGAGAGTTAATGGAATCCACTCCTAGTTTCCATTTCAAACAGGGT
GAGAACATCTGACCTTATTTGATAAATAATGGCACCTTTAAACATTTCTATTATCAACTG
TCTGCAGTAACAAAGGGAATACTATTAGAAATGTTTAAATAGTTTAGAG


invisible?    
Gene introns: 0  

Shown 841-870 from 3142 sequences on 29 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs