Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 871-900 from 3142 sequences on 30 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>15899 251 884     19q13.12    chr19:36924836-36925086 BLAT!
GATATGGCAAATATTTTATATCCAGCATAGCAAAATCAAATACTTTTATCAACATATGAG
TGTCAGGGACTCTTGCTGGTTAAAAGACTTAAAAGATATGTCAAGTAATAAAAAAGGGAA
GGCAAAAGCATTTAGGGATGTGCAAATGGATAATAATATTATAAAGGAACACAAGGAAGT
GATCACTATAAAAGTTAGGAGAGGGATGGGCTCAGTGGCTCACGCCTATAATCCCAGCAC
TTTGGGAGGCC


invisible?    
Gene introns: 0  

>12170 115 883     8p12    chr8:33225664-33225778 BLAT!
GGCAAGGGTATATAGCAGAGAAGAAGCCTCAGGAAGATAAAAGAAGGTATCTGCTGGTCA
TGACTGGTCATATCCTCTTTGGGATACAGCCACACCTCTGACTGACCAGAGGCTT


invisible?    
Gene introns: 0  

>1335 176 881     4p16.3    chr4:2092353-2092178 BLAT!
TCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCTATAACTACGATGAAGATTTTGAA
GATGATGATCTCTACGGCCAGTCTGTAGAGGATGATTATTGTATTTCGCCGTCAACAGCT
GCTCAGTTTATTTATTCACGGCGTGACAAACCTTCCGTTGAGCCTGTGGAAGAATA


invisible?    
Gene introns: POLN (2073644 - 2230958)  

>22997 222 881     4q22.1    chr4:92265407-92265628 BLAT!
GACACCAGTTCTTGCCAGTGCCTTGATTTAAGTTTCCCAAACTCCAGAACTGTGAGAAAT
TTTTATAAGTTACACAGTCTAAGTTATTTTGTTACATCAGCCCCAATGGACTAAGACTTC
GGCATAATAATTATAACAAAGAAATATCTACATTCTACATTTTAAAGCATAATAATGATT
TCTTCCAATTTCTGATATGGAAAGAAAAAGTAAGTGTAATGT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>28431 216 880     2p25.2    chr2:5739655-5739870 BLAT!
AGATTTCTGGCATAAATAGTCAAGGAAGTTATTTGGAGTGAGGCAGGAGTTTCATTTCAT
CACTCTTAAATTCAAAATGCCAAAGTAGACTAAATATTTGTAATAGAAAGTTGTAGGAAT
TTCAGAATTCCTTTCAACTAGACTTGTGCACAAAATTTAGATCAGAGATTCTACCAAGTC
AGATAAAATTTATGGAAGATGGGTTTTAAATTCAGA


invisible?    
Gene introns: 0  

>18851 204 879     4q28.2    chr4:130452942-130452739 BLAT!
AAACCTAGGTGTCCTCAGACTTTATGTAAACCTCCTTCCAGAAAACTATGTTTCTTCTCT
ATTTATGTGAACTCCTTTTGCTTATTTTTATTCATTTATTCACTCATTTAATTCAGCACA
TATTAACATTTAACATTACCCACAAAATGTGAGACACAATCCTAGGCCCAGGGAAAACAG
CCTTGAACAAAACGAAGTGTCTGC


invisible?    
Gene introns: 0  

>19616 210 878     Xp22.2    chrX:11584538-11584747 BLAT!
AGCTATGCTAATACACACTCTGCTTCCCTTGGAGATTACATTCTCACTCTTTGTTGTCTT
TGTAGAATTGCTGATCACATGAATAAAATGTTTATGTTAATTCATAACAAAATAAAAGTG
CTGAACAGAAACTCACTTAAACTCTTCTGGAACTTGGTTTTCTCTATCATTAAACTGTGA
TTATAATCCTATTGTTTAGGGGGTTTGTGA


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>20067 173 875     12q15    chr12:68211488-68211316 BLAT!
GAGACCACAGTCACTACAGAGGAATAGCCTGTAAGGAAAAGGATCAGAGAGAAGATCTCC
AAATTCTATCTGCTTTTATTTTCAATAACTCTTGAACCACATGTGTCAAGTAGGCTCAAA
ATAGCTCTGCTAAAGACAAAAGATATGAACTGCATTTGGAGATGCTACATAAG


invisible?    
Gene introns: 0  

>21910 227 875     17q22    chr17:51086579-51086353 BLAT!
TTTAAATAGTGACATACTTTACTTTCTCAAAATACTTTACCAATTCAAGACCTTCTCCAG
AAGTATCTTGCCTCTTCTAACAATGCCTGCTTACTCCTATGTGAACAGGGGGGTATAAAT
TGCATTATAAATTTCAGGTTAGTATTAAGAAATTTTAGATATGCAGATTTCGATTAAACT
TGAACTTTTTCATTCCTCAATATACTGTGGCAGATACTGATATAGCT


invisible?    
Gene introns: 0  

>16828 206 874     6q21    chr6:114241746-114241541 BLAT!
ATAATGTAAATGACAAGCATACTTACCACATACTTACCTCTGGATACACACTCAGTGGAT
CTGAGGTTCAGAAGAGTGAGGCTGGGGACCAACAGGTAAACATCTTTTCAATCAAAATGA
CAAAGGTCTGAGTCAAGGAGCAGGATCAGATTTGATATTGAAATATTTGTTGACAGATGA
AATACAGAAAGTTGTAGATGTTAGTG


invisible?    
Gene introns: FLJ34503 (114225550 - 114242806)  

>30194 197 874     13q21.33    chr13:71860578-71860385 BLAT!
TGGAAAAGGGGGGAAAGAGTGGGAAGGAGTTTGTCTTGTGACTTGGGTGCCAGCTCAGCT
ATGGAAAAATAGAACACCAGGTAGATTCCTGAGGTTTTCTACTCCAGGTTCTGGTTCCCA
GATAGCAACTCTGGACCTGCTAGGGACCAGGGGAAGCTCACTGCCCTGAAGGGAAGGATA
CAATCCTGGCTAGCTTT


invisible?    
Gene introns: 0  

>31724 172 874     Xq22.1    chrX:98330244-98330415 BLAT!
TGCTGATGCTAACCAGAAACAATGTATAGAATTTCTAGTTCAAGCTTCAGATGCTTAGAT
ACTTTTGCAACTAGTTAGCAGAAGAAAGGCACAAAGAGTGCACTTAGCACTTCTCCAGTG
TCTCCTGCCCAGTCCAGCATGTAAAGAGAAATCTCAATTACCAATCCTTGAG


invisible?    
Gene introns: 0  

>26901 217 873     12q24.21    chr12:116190507-116190291 BLAT!
AGCAAAAGTGACATATATTATGAAGGTAGAGTCAAATTATCTGAACTAAAACTGGGGATG
CATGAACCAAAATTTTTTCTTGACCACTTCTCAGTGTGAGAGGCAAGGATGGGAATTAGT
TCAGAGGCCAAAAGACTTTAAGTTCTGGGACAATGGATGATTATAGAAACACTGCTACAA
AGCATCTAAAGTGGGAAGAGTCCTCAAAATCGGGGGG


invisible?    
Gene introns: 0  

>4455 197 870     6q14.2    chr6:84558627-84558431 BLAT!
GAAAAATAGAGGGAGAGTGCTGGGTCCATAAAGGGATCTTGGTTTTAGGGTGCAGACAAA
AGTATGTTTAGAAAATGAGGAGAGGAGGCAGGAGAGGAGACGCTTCTGAAGAGACAGGGG
CTGGATGATGGTTCATGGTCCCCAAAGAGGAAGGAAAAAATGAGATCAATAGCCCTGAAG
AAAATCCTCATGAGAAT


invisible?    
Gene introns: 0  

>12626 215 870     14q31.2    chr14:84759600-84759814 BLAT!
CATGAATTTTCTCACCTCCTTCAGGTCTTTATTCAAATGTCACCTTCTTGATGACATCTT
CTATCCCAATAACCCCATTTAAATTGTCATGATCTCAAGCACTGCTAATTTCCCTTACCT
GGCTCTATTAATTTCTAAAATATTCATCACCTTCTATTTTACTAAGCCATATACTTACTG
ATTAAGTTTATTGTCAATTTTCTATCATGTCACAC


invisible?    
Gene introns: 0  

>18156 214 870     11q14.3    chr11:88823597-88823814 BLAT!
CAAATTATAGCATTTAATTCATCTTATGGTGGATAGTGTTCCTTTGTGTGTGTGTGTGTG
TATATATCTCCAGATATAGTGTTCCATTGTGTGTGTGTGTGTTTGTGTGTGTGTGTATAT
ATCTCTATATATAGTGTTCCATTGTGTGTGTGTGTGTGTGTGTGTAACATTTTCTTTGTA
TATTCGTTTGTTGATGGACACTTAGGTTGATTTT


invisible?    
Gene introns: 0  

>29183 181 870     16q21    chr16:63055093-63055273 BLAT!
TTGTTACAGTTGGCTAAATAGGTCATGTTCTTGCCAGCCTGAAAGATGTTTTAATTGATT
GATATGTTTTTGTATACTAACTGATAAAGATAACAGTGCCCTTAAGGAGAACATTGTAGC
AGAAAAGACAGAAAATCATAACAAGATGAGACAAATGCTGTAACACATTTATATACACCT
A


invisible?    
Gene introns: 0  

>29633 276 869     9q32    chr9:117609461-117609236 BLAT!
TTCATCTTCTTCCTCTACATCAAAGTCTTCAAGGTTATCATCAGACGAAGATTCCTGCTC
AACTTTCATTCCTTCAGAAAGACTTCCTTTAAATTTATCTTCCTTTACTTTGCTTCTGCT
CCTTCGTCTACGACCACCGCGTGATCGAGACCGCCTTCGCAAGCGTGATCTGCTCCTCCG
ACCTCTGTCCCTTCTCCGAGGAGATCTGCTTCTTCTTCTTGGAGACCTGCTACGTCTGAG
TGGGGAACGAGACCTCCTTCTAATGGGAGATCTACT


invisible?    
Gene introns: 0  

>15679 178 867     4p16.3    chr4:2092376-2092199 BLAT!
AAGGGGCTGTGGCAAACGCCCTCTCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCT
ATAACTACGATGAAGATTTTGAAGATGATGATCTCTACGGCCAGTCTGTAGAGGATGATT
ATTGTATTTCGCCGTCAACAGCTGCTCAGTTTATTTATTCACGGCGTGACAAACCTTC


invisible?    
Gene introns: POLN (2073644 - 2230958)  

>21261 184 867     Xp22.2    chrX:11170200-11170383 BLAT!
AGAGCATAATTCTGTATTTAAGTTGGTGCTACTTTTTATCTCTAGTTTACAGATGAGGAA
ACTAGAGAGAGAGATCTATCTATGTATTAACAGATATTAACTCTTAACTAATAGACCGCA
TATATAATAGCAATAGAAATGGAATTGAAACGTAGGCAATCTGGCTCTGGATCTGAAATG
GTAA


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>25198 190 867     11p15.4    chr11:5219650-5219839 BLAT!
ACACTTATCTTTCTAACCAGATACTTTACTCTGTCCAGAAACAATTTCCTCACTTTGAGG
CTTAAGCTATTAGAAACCAAAGCCTGTATTTTTGTTTCCCTCTGAGTCAAATAAGTAGAC
AGAGGCTATGTTATTGAATGAAGTCCAAAGTGAAAGGAAAGGAAGGCATAATTACAGGAA
GACAAATCTG


invisible?    
Gene introns: 0  

>30893 195 867     1p31.1    chr1:80340859-80341053 BLAT!
CAACTGCCCTCCTGGGAGTAGCAGGAGACAGGGGAGCCCCTGCCCCCCACTGTGGGTAAA
TGGTAAGTGAGTGGTTGTCCCTGGGGACTCACACTTCTGCCATCAACTTTTGCAACGCTG
GGCTCAGGAGATCCCCATGAGTCTCCTCAGTAAGGCCTCCAGACTGACCTGGAAAGCTAC
ATGAATCTGGGCAGA


invisible?    
Gene introns: 0  

>4739 154 866     12q21.31    chr12:80572861-80572968 BLAT!
TTGGTTTTTATTGTGATGGGGGCGGTGGGGGCTGGGGTAAAGTGACAACTCACTGGAGCA
GGCTTATGTGGTCTGAACTTCCTGCTGGGGCCAAAGGAAGGAATACTCACCCCGCGTACG
CGGGGCATAATCATTTTCCTTATCTGCTTCCTAG


invisible?    
Gene introns: 0  

>20071 226 866     18q12.1    chr18:26231973-26232198 BLAT!
TATATTAGTTAATTTCCACTGGCAAGTTTCAGAGATATTGGACAGATACAAGTCCAATTC
TGCTCAACTGCTTGTTGAGGCTCGAGTTCAGCCTAATCCATCAAAACATGTTCCCACATC
CCATCCCCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGAAAGGAAAACCTACTCTC
TCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCAC


invisible?    
Gene introns: 0  

>26011 154 865     3q11.2    chr3:96069343-96069468 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGTAGAGGGGGAGACCTCATGGCCTATGACAGAA
GAGGGAGACCTGGAGACCGTTACGACGGCATGGTTGGTTTCAGTGCTGATGAAACTTGGG
ACTCTGCAATAGATACATGGAGCCCATCAGAATG


invisible?    
Gene introns: 0  

>28267 165 865     13q14.2    chr13:48626594-48626758 BLAT!
CAATAAGATGTTTCAATCAACAAGATACTTGGGATGCAGAGAAAGTGACTATTTAGGTAA
GATATTCTTGCAACCCCAAGAGAGGTAAACCAGACCACAGGTGGAAGTCTGTCAAGTAGG
AGCCATGAACTGCCTTGAGGGAGTTGGAAGCAGCTTTAAGACAGT


invisible?    
Gene introns: 0  

>30330 207 865     5p13.2    chr5:34478710-34478504 BLAT!
GTCTCTCTCCTTCTGCCTTCTGCCCCTCAAATTCTTTCTTCTGTGGAGGTAAAAATTGAG
GTTGTTGCAGACCTGTCTGGATACGGATTTGCCCTGGATTAACTGCCCTAAACAGTTCTA
TTGACTCTCTCCCTGACAGTGTCACTTGCCAGCCTATCTTCACAGGTAGAGGACAAGGAC
AACACCAGAAATCATCCCTTTGCCCAC


invisible?    
Gene introns: 0  

>3261 217 863     9q33.1    chr9:121756081-121756297 BLAT!
CTGTCTCACTGCTATTTTCTTTTCTGTCTTATAAATCCTTAAAGAAATGTAGTATGAGTG
AATTTAGTGAGAGGCTGGATGGATGGCTCCAGAGAATGAATTCTCTTCATCTGAAGAACA
GTCTCTATACACAGAGAAGCAAATAGCATCTTCCAATTCTGTCAATGTGATTATTAAGCA
TGTATAGAGCTTTTCCCTCTTTCACTATAACAGTTAC


invisible?    
Gene introns: 0  

>20462 211 863     2q35    chr2:218144030-218143820 BLAT!
TGTTACTGCAGAGTCGGCCTCCTACAGCCTCTGCTTGCTCACTCTATTCCCAAGTGCAAT
CTCCATGTGGCCCTGCAAGGCATTTGGCATCCTCCTCCTGTGAGCTGTGAGTAAATGTGA
CTACTAAACTGCTGTTAATCTCATCTGTCCATTGTTGGGTATCATGTTCAGCCATCTCAT
TCTGTGTAGGGTGGGGAATCTCTCCCTCACA


invisible?    
Gene introns: 0  

>22171 200 863     7p14.1    chr7:42834884-42834685 BLAT!
TTCCTTGCAAGCAAGTCGATAGCCACTAATAACTGATGTGGGATGAATTTTCTGTTTGAC
TAATTCATCTGCATTTTTTAGGAGTTCTGCTGCAATAATAACCACTGAAGTAGTTCCATC
TCCAACTTCTTTGTCTTGCAGATCAGCCAGCTCACAAAGAACTTTAGCTGCAGGATGTTC
TACCTCCAGTAACTTCAGGA


invisible?    
Gene introns: 0  

Shown 871-900 from 3142 sequences on 30 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs