Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 931-960 from 3142 sequences on 32 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>17741 195 829     6q13    chr6:72774416-72774221 BLAT!
AAAAACATTTTTTTTAAACTTCATCATCATAGAAATGAAAAACAAAGTCTAGCTCTTTTA
TTTGCCAGATGAAGTCCAGTGAGGTTAAATCGCTTGATCGAGATGACGCACCCAGCTGTG
CTGGAACCACATTGTCACAGCATTGCATTCACAGCTTCCTGTCAAGTGGGCTGATCTTCT
TCCCTTTATGCATTT


invisible?    
Gene introns: RIMS1 (72596649 - 73112845)  

>6696 207 828     22q12.1    chr22:27342247-27342041 BLAT!
TTATGTTTCTCCTATACATAAATACCTATAATAAAGTTTGTAAATTAGACACAGTAAGAA
GAGATTAACAACAGAACAATACTTAATAACAAAATAGAACAATTATAACAATATACTGTA
ATAAAAATAAAATAAGGTATTCTTTCAAAGCTAGCACTGTGATATCTCAACAGCCAATGT
GGTAACCAAGACAGCCACTAGTGGATA


invisible?    
Gene introns: 0  

>15255 199 827     5p15.2    chr5:10209313-10209511 BLAT!
GAAAACATGCAATCATCTTGACAGAAACAGAAAAAGCATTTTGAGGAATGCTTTTAATCA
AATGATTGACATCAATTCATTATTTGTAAAACCTCAGCAAACTAGGAATATAATAGAACT
TTGTCAAGCTGATAAAGATCATGCTCAAAAAAACTACAGCTAAAGTTAACATAAAGCTTC
ATGGTGAAAGATTGAATAC


invisible?    
Gene introns: 0  

>27577 273 827     2q22.3    chr2:147146488-147146223 BLAT!
GTGTATGAAGTCAAAGCAAAACATTTATCACAACTTTTTTCATAGAATGCTCTGGAAGCC
AAAAATATCAGTAGTTGTGACTCAGGAGCAACAAATACATAATTAGTTGCAAGAAAAGTT
TAAAATACATTTTAAGCTCTTGTTTTTTCTTTATTTCTCTATATGTAATTTTGCAGAAAG
GTAGGCTATCAAAATGAAGGATTTAAAAAATAAATGAAGCCGGGCGCGGTGGCCCACGCC
TGTAATCCCAGCACTTTGGGAGGCCGGGGCAGA


invisible?    
Gene introns: 0  

>5181 177 826     8q13.2    chr8:70282058-70282234 BLAT!
TTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTTAATGAGTATTTTTTTTTCTA
ACTACAAAACTCAGATAAACCTCTTGAAAATGCTCATGGGCTAAATGCTTAAACTGGCAG
AATATATTTTTCAAAAAGTGTGTTTTGTGATAACTTTGTTTTATTAACATTTAGTGG


invisible?    
Gene introns: 0  

>5616 171 824     5q34    chr5:164824581-164824751 BLAT!
ATAATGATTTCATAAAACTTACCAATACAGACTAAAGACTGTTTCCCTTGAACTACAAAG
GCATTTGCACTCAATCATTTTCACCTGATAAAACCATACCCTTGTTCAAATACAACCTGC
TGCCAAACCACACCTGCACCTGCACAAGTGAACACAGGTGGAGAAACACAC


invisible?    
Gene introns: 0  

>8611 231 821     11q22.1    chr11:97567705-97567934 BLAT!
CTCTTTCCTCTGATATTCATACCTATATATCCAACAGGTTATTTGTAGAAACTTATCTTC
TCTGAAATTGAACTTCTAATCTATTCCTCCACGTTTTTTTCTTCCCAGTCTTCCCTATCT
TAGTTAATGGCAACACCACACTCTTTGTCAGGTAACATTTTGAGAGTAATTTTGACTTCA
TTATTTCTTTCAACTTGTAAATTTAGTATGTCAGCATATGCCATTATGGTT


invisible?    
Gene introns: 0  

>10118 169 821     2p14    chr2:66470243-66470411 BLAT!
TTCACAACAGAAGTTCAAAACGCTTTACCAATTATTTGTTTGGAAGCAGACTATGATTTC
TCATCCTCTGCAGTGAATGCTGTTGTGGTAATAAGGAGGAGGAGGTTGACCATACTGTGT
CTGTTTTTCAATATTTTGGTAATGCTTCCTGATTCTCTTTTGGGGAATT


invisible?    
Gene introns: 0  

>7494 190 820     5p15.31    chr5:6384385-6384196 BLAT!
CACTAAGCCAAAAGGAAAAGCCAAGTTGGGAACTGCTTAGGGCGAACCTGCCTCCCATTC
TGTTCCTAAAAAACGTAGCTACTAAGATTAAAAAGCGACATACCTCCCTCACAAGGAATT
TCTCTGTGGACAAAGGACAGACAGAATTCAAAGTTGCCCTCTGCTCACTGAGATAAATGC
ATATCTGATT


invisible?    
Gene introns: 0  

>26508 166 820     Xq21.1    chrX:82810442-82810607 BLAT!
CAACATAAATTTATCTGATTTGATATTTAAAGTGAAATGAAGTTTTCATTTAGCAGAATT
TTAATACATAGAAAATTTAGTTAACATGTTTCAATTATGAAATTAACCCTGCAGATAGGA
TTCTTTTCCTGTTTTAAAACTAAACAACCAAATACCACGTATTCTC


invisible?    
Gene introns: 0  

>1743 216 816     10p11.21    chr10:37057565-37057350 BLAT!
AAGATCTCAGCTCACTGCAGCCTCAACTTCCCAGGGTGAAGCGATCCTCCCATCTCAGCC
TCCTGAGTAGCTGGGACTACAGGTGTGTGCCACCACACCCAGCTAATTTTGTGGGTTTTT
TTGTAGAGATAGGGTTTCACCATGTTGCCCAGGCTGGTCTCGAATTCCTGGGCTGTAGTG
ATCCACCCACCTTGGCCTCCCAAAGTGCTGGGATTA


invisible?    
Gene introns: 0  

>9805 238 815     5p13.1    chr5:42179564-42179327 BLAT!
AGATCACAAGGTCAGGAGATCGAGACCATCCTGGCTAACCCAGTGAGACCCCGTCTCTAC
TAAAAATGCAAAAAATTAACCGGGCATGTTGGTGGGAGCCTGTAGTCCCAGCTACTCAGG
AGGCTGATCAGGAGAATGGCATGAACCCGAGAGGCGGAGCTTGCAGTGAGCAGAGATCAT
GCCACTGCACTCCAGCCTGGGGGACAGAGCGAGACTCCATCTCAAAAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>8918 186 813     8p11.1    chr8:43837317-43837132 BLAT!
GAAATGTTCAGCACAGTTAGTTGAGTAGATACAGCATAAACATGTTTCTGAGATTACTTC
TATCTCGCATTCATGGGACGATATTTCTTATTTCCAGAGAGGCTACAAAGCCCCCCAAAT
GTCCACTTCGAGATACTACAAATAGAGTGCTGCACAACTGCTCTATGTGAGGGGATGTTC
AATTCT


invisible?    
Gene introns: 0  

>11028 189 813     6q14.1    chr6:80776567-80776755 BLAT!
ACTCTTCCTTCGGAGAGTGTGGGCTTTGAGTCTTTGGCTCTGATTTAGCACCAAGCAAAG
TTTGCCTGATGCTGAGACTCTGGCGAGGTGTTTTTGGCAACTGTTCTGCTTTGCTCATCA
GATTGTTGTATTCTTTTATTCTTCGACTAATTAGATCCCTGTTAGTGACTCCAGTGTCCT
CTTCGTTTA


invisible?    
Gene introns: 0  

>23437 189 812     2p14    chr2:66357940-66357751 BLAT!
ACTTTTTCAAAACACACAATTTCCGCCATAGACTGTAACATCTTTAGAGTTTAAAACACC
TGAAAAAAATCGGCGAGGGTGAATCCATCTTTCAAGTTACAGCCTTCATCAGCATTCGGG
GTGTCTCTGTTCTGCCTGCTCAGATTTTCACGTTGAAACTTAGCAACTTTATCCTTCTTA
CAGCAACTC


invisible?    
Gene introns: 0  

>17489 239 811     4q32.1    chr4:161610905-161611143 BLAT!
ATTTTCACTCTCCATTTGATGGGATAATTTGCTGATGGGACAATTTACTATGCAAATTGT
CTACAAAATAAAATTATGCATGCTAAAAAAGAAGAAATTACATAACCTGCTCCTGTATGA
CTTCTGGGTAAATAATAAAATTATAATTACAATCAATAATGTTTTTGAAACAATGAAAAC
AAAGATACAACATATCAGAATCTCTGGAACACAGCTAAGGCTGTGTTAAAAGGTAAGTT


invisible?    
Gene introns: 0  

>10510 209 808     11p12    chr11:42779733-42779941 BLAT!
AAGATATCTTCTGTAGCCCACACATTAGTGTGTGTGTAATAGTCAAGCAAGTTACCAAGC
TGCTGTCACAGAAGTGGCATGCCAGAGTGGGCTCAAGAAGTAATCAGGGAGTGATGGTAT
GTGTTTAGTAATAATAAGAAAAACTGTGTTAGTCCCTAGGTTTCTTTTCACTGGCCAAAA
GCCAAGACAGTCTGTTATGATATAATCCT


invisible?    
Gene introns: 0  

>14645 168 808     20p12.2    chr20:11408582-11408749 BLAT!
TTGATTTTATCAGATACTATCATTATCCCATTTTATAGAGCAAGAACCCAAGGCTTAGAT
AGGTTTACTGTCATGTTCATAGATACGCAGCTAGAAAGGCTCATAATTTTATTCAAACTC
CCACCCATCTGATTATAAAACTAGGATTCCTAAATACCACAATACAGT


invisible?    
Gene introns: 0  

>17755 205 808     4p15.1    chr4:30547523-30547727 BLAT!
ACTTTATACATGTTTCTTCAGCATAGAATATTCCATCTCTTGCACACCATCCCCAGCTCC
AAACCCCATTGTTTTAGACTACATCCAACCAACTTTCAGTTTTTATCATAAAACGAACCT
AGTCTTTTCATTACATGTTCTTATAACATCCTGTATTTCTCCTCAATATCACTGGTAATA
ATTACAGTCAATATTTCGTATGTGA


invisible?    
Gene introns: 0  

>5149 185 807     5p15.33    chr5:3094882-3095066 BLAT!
AGCACTAATAGTTTAATCACTTTTCTTTTTTACATAATAGTTCCATGCTTACATAATGTT
TTACATGGGTGGTATACTATTGCATTTGTATCTTCATGCCTTGCTTTTAAGGTTATATCA
CACAAGCATTTTCCAACATATTGAAACGTTTTTGTTGCTTGCCAAATGTTCATTCAGGTA
ACTTG


invisible?    
Gene introns: 0  

>10998 261 807     Xp22.2    chrX:14262889-14263149 BLAT!
GTTCCCTTTTGACAGACTGCAACCCTGCGGATCCTCTGGTTGGAAGCATAGCCACTCAGT
ATTTGACCAACAGAGCAGAACACGACAGGATAGCCAGACAGTGGACCAAGAGATACGCAA
CATAATTCACATAATTTGTATGCAGTGTGAAGGAGCAGAAGGCATCTTCTCACTGTGCTG
CAAATCTTTATAGCCTTTACAATACGGACTTCTGTGTATATGTTATACTGATTCTACTCT
GCTTTTATCCTTTGGAGCCTG


invisible?    
Gene introns: 0  

>26025 180 806     3p26.1    chr3:5766360-5766181 BLAT!
TTTTTTTTCCACTTAAATAAATTTTAATATCTTTTCACATCAACGTATACTGAGCTTGCT
TCTATGTGTGTGTGGGTGTGTGGATTTTTGCTTTTTAACAATTGGATATTCTTTTATGGT
AGAAATATACCATAATTCATTTAGTCAATGCCCTGTGATAGATATCCAGGCTAAACCTAA


invisible?    
Gene introns: 0  

>11172 170 805     9q33.1    chr9:121755615-121755446 BLAT!
GAGCTCCTGGTTCTCTTTTTGAAGAGCCTCGCCCTTATTACCCAGGTAAAAGTAATTAAA
AAAGAAGTGATTTTTCTACCCCCAGTGATTTCCCACAGTAAGAAGGAATGAAAGATGTTG
TAAATATTTACAAAGGAGAAATAGAGACAAAATAAAGTAGGTTACGACTT


invisible?    
Gene introns: 0  

>11892 239 805     3p22.1    chr3:41139526-41139764 BLAT!
CCCACACAAAATAGCTATCCCATATCCAGTTGTATGCTGGCAAATATTTAAGAACCAGCT
GTCCCTGAATTGTAGCATTTTTGTGTGGGATCTAAATACTCCCACTGTGGCCAATTTCAA
GCTACCAAGGTCATTGAACATGAAGCCGGGGAGAGAGGCATACAATTTTCAAGAGCTGAC
ACAAGCCAACTGCAGCACATCATTTCCCACACCTCTCCAGCATTCTCGGTCCCTTTATC


invisible?    
Gene introns: 0  

>10999 187 803     3q12.2    chr3:100898531-100898717 BLAT!
GCTTCAGGAAAATGGATCATCCTGTGAATACAGGGTCCAGCTCAGCATCATGTGCCAAGG
AAGACCTAACTGTCATCAGATGATGAAATCAGAAGGATTCCACAGGCTGGAGCAAGACAT
TTACTGGGATCCAGTTTCCTTCCACTGCATTCCTACAGTTCCGGGTTGGCTGCCAGCAGT
TGCCTGC


invisible?    
Gene introns: 0  

>31510 102 803     9p24.2    chr9:2255862-2255927 BLAT!
AGCGGCCGCCCGGGCAGGTCGGGCAGGTACGCGGGGGACCACCATAACTTAAAGCCAAAG
GGTTCAAGAACCTGTTGATATGATTCATCCAGGTCAGAAGTG


invisible?    
Gene introns: 0  

>31614 189 803     6q22.32    chr6:126850071-126849883 BLAT!
ATGTTACTTATTGAGAATGCATATTGCATTTCTCAGATATATTGTTATTTGAATATTAGA
AAATAACTAAAATGAAGAATACATATATTTCATTTGAAGTTATTATAAACCACTAATAAA
TAGCTCTAAAAATAAAGTCATTCAGAGATATCAAACAATACGTCAGTCTTCCTCACTTTT
ATTTCTATA


invisible?    
Gene introns: 0  

>28698 175 802     2q13    chr2:113690696-113690869 BLAT!
CAAAACGAGAATTTTTAACGGAAGAAGAACCTGATGACAAAGGAGACAAAAAGAACCAGC
AGCAGCAGCAGGGCAATAACCACACTAATGGAACTGGCCACCCAGGGAATCAAGACAGCA
GTCACACACAGGGACCCCCGTTGAAGAAAGTGAGAGTTGTTCCTCCTACCACTAC


invisible?    
Gene introns: 0  

>30693 184 801     3q22.1    chr3:130321907-130322090 BLAT!
GGGAAATAAACAGCAAATCTGACCTTTACTCATTTGAACACCTACAGTCCACCAGCAACA
CTACTAAATACTAGAAATAAACTCAACTACAAGCTTAACTAAGACCATCTTTCCTGTCAA
GGAACTTAGAATCATGTTGTAGAGTGTGGTTTCTCAGCCTCAGCATTATTGGCATTTGGG
TTAA


invisible?    
Gene introns: COL6A6 (130279177 - 130395888)  

>6608 206 800     2q22.1    chr2:142149150-142148945 BLAT!
TAAAGACTAGGCCCAAATCAATTACCATGGTGTATGAGGCTCTTCATTTACCCTTTCCTT
TCACAATTTTTTTTCCAACCTTATTGAAGTTTTGTCAGCTTCTCAAACACGCCACCATCT
CTGTTGCCTGTAAGCCTGCACTGTGTGTCACATGTTTGTGCTCCCTTCTTGTAATACTGT
CCTTCACTACCTTAACCTGACATTCT


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

Shown 931-960 from 3142 sequences on 32 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs