Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 961-990 from 3142 sequences on 33 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>14957 241 800     9p21.1    chr9:29835638-29835398 BLAT!
AGAGACCCCATCTCTACACACAATTTTTAAAAAATTAGCTGTGCGTGATGACATGTGCCT
CTAATCCCAGCTAGTCGGGAGGCTGACGTGAGAGGATGACTTGAGCCCAGGAGGTCAAGA
CAAGCTTGGACAACAAAGTCAAACCCTGCCCCTGACCCCAGCAAAAAATCAGCTGAGCAT
AGTGACACAAGCCTTTGATCCCAACTACTCAGGAAGCTGAGGTGGGAGTCTCACTTGAGC
C


invisible?    
Gene introns: 0  

>19361 197 800     21q22.3    chr21:44242108-44242304 BLAT!
TAGAGTCTCTTAATAGCAGAATTGATCAAACAGAAGAAAACATCAGTGAGCTTGAAGATA
GGCTATTTGAAAACACACAGTCAGGGGAGATGAAAAAAGAATAAAAATAATGAAACATGC
TGACAAGACCTAAAAAATAGCCTCTAAGGGGCAAATCTAAGAGTTATTGCCTTAAAGAGG
AGGTAGAAAAAGAGATA


invisible?    
Gene introns: 0  

>30423 174 800     8p22    chr8:14986937-14987110 BLAT!
AAAGTAACATCCAAACTGTTTAACTAAAATTCTTCCAAGATGCCTCCATCTTATTGCCAT
CAAATGTCCTCTCATCTCACACATCCACAATGGAAAGCTTTTAAGAAATTTGTCAGAAAC
TCACAAGCAAGGAAAGAAATAGCACTGGAAAATGTTTCTTATTACTTGAGAAAA


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>26286 127 799     18q12.2    chr18:34731395-34731297 BLAT!
ATTTCAGAATAAGTTTGCCAACTTCTATAAAACAGTATGTTGGTATTTTGACTGAAATTG
CATTGAATCTAAGACTCAGTTTGGAAAAAAATTTTGATACCCCGCGTACCTGCCCGGGCG
GCCGCTC


invisible?    
Gene introns: KIAA1328 (34409079 - 34805288)  

>26477 207 799     Xp22.2    chrX:11668433-11668227 BLAT!
TAAGAAAGTTGAATGATTGGGCCGGGTGCAGTGACTCACACCTGTAATCCCCTTGAAAGC
AGGCTGAGGCAGGAAGATCACTTGAGGCCAGAAGTTTGAGACCAGCCTGGGTAACATAGT
GAGACCCCATATCTACAAAGGAATTTTAAAAATTAACCAGGTGTGGTGGTGGGTGCTTAT
AGTCCCAGCTACTTGGGAGGCTGAGGC


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>8349 184 798     2q22.3    chr2:146215660-146215843 BLAT!
GGCCCAGAACATCTTAAGGATGGAATTTAACCTTAGTTTCTGTCTTGCAATCAGGAGAGG
AGGTGAGAATGTCTGAGCAGACAACCTGTTGCCTTGCAGAGGAGGGGTTTCAGAGCTTTT
TTCCAGCATATAATAAATGCTAATTCTGAAAAAGTTTGGATAATTTCTGCAAATTCTGAG
GCTT


invisible?    
Gene introns: 0  

>28462 184 798     9q33.1    chr9:120722557-120722374 BLAT!
CCCACTCCCAGGCTCAGCATAGAGAAATGGGGCCTCAAATCAATTTAAAAATCATTATGC
ATTATTTGCATTTGACTTTTTAGTGGAAGCTCAAAAACATTTTAGGATTTTAGAGTGATA
ATTAGACCTATCATTTTTAGACAAATGCCACAAAATTTGTCCATTCCTGCAGCAAATCTT
GCTC


invisible?    
Gene introns: 0  

>11612 175 795     6p22.3    chr6:25052644-25052469 BLAT!
AGGGCACTGTCTTGAGCAACTGGGTAGAAGGTCATCAAGACAGGAAATGCTGGTGAAGCC
AGTTTGGGAGGGAGAAAGAGAAGGAAGGAGAGAGGGCAGTAATGGGCTGTGTCTGACTAG
AAGAGAACAGATAAGATGCAGACACTGTCCTCTCTCTAGGCTCATAGCTTTTTCT


invisible?    
Gene introns: 0  

>20134 187 795     13q33.2    chr13:105490721-105490535 BLAT!
TAACTATCCCCAAAGCCTGAAGCAGTTATTCTCCCAAGAAGGCCACAATAGGATCTGCAA
TGGCTGTTTCATAAGTGGAATAACATAGCACAATCTGCCTAGCTGATTAGGGGCGACTCT
GGTCCTGCACCTCATGTGTCCTGAAGTCAGGGCTCAGCTTCTGACAAAATCTCCCTCTGT
CTCGTTT


invisible?    
Gene introns: 0  

>25776 187 795     10q25.2    chr10:112774937-112775123 BLAT!
AAATAAACTGGAGAAGTATACATTCCTGAAATCTATAAACTTTAAAATGAATTACTTGTG
AGGAAAGATCTCCTTCTGCCTTGATCAGAGGATAAGATAGTGTATCAGATGTCTTAGCTA
AAACTTATCTCTTGCCTTATTCTTTTGAGTAGTTTAGTCTTTAGGAGTCATTGGGAAACG
CATGGCA


invisible?    
Gene introns: 0  

>6890 268 794     2p15    chr2:62718966-62718699 BLAT!
TATTTGATTAATTTTTTTAAATGGGAAAACCCTTTGGTAGAGTAATTTAAAAGATTGTCA
TTTGCTGAAGTAGGTCCTTGTGAAATGCTACGTGCTTTCATGTGCTATCTTATTTACTCC
TCTAAGGTATTATAACACTTGTATATTATGTTAACTTTATAATTATAATACCATTTCCCA
TTTTGAAAATGAGAAAAACAGAGTATTCTAATAAGTTAACCAAGATCGCCTAGCTGGTAA
TTGGCAGAACTGGGATTCAAATTGAGGC


invisible?    
Gene introns: 0  

>7639 161 794     13q33.1    chr13:104189530-104189402 BLAT!
AATCTCTCTCTTCTCTCTTCTCTCTCTCTCTTTGTCTCTCTGTCTATCCTAACCAAGCTC
AGCCTGCCCATTCAGAACACTCCAATTCAATAAGTAGGATGTTCTATGGTGAAGCTGGCT
GCAAGCATCATGCTAATTTTACTGTTCTCATAATCCCAAGG


invisible?    
Gene introns: 0  

>8056 293 794     4p15.1    chr4:28811353-28811645 BLAT!
CATAGTTCACTGCATAGTTTTTCTGTCCAAGCAAAGGAAGATTATTAAGGACTTATCTGA
CCAGGGACTCTCTCATTTGGGCCATCTGTCTTTTTGTGCTTTCTTGAGGGAATGCAACGA
GAGAACTTTTTTCCCTTTTTTTTCCTCTCATTTAGTGTCTTATGAGATTGTATGTGAAGC
CATATTTTAAGAATCTGAACAAGCAGAAACACTGCCACTTTGAACACTTTTTATTTTCCT
TTGTGCTTGCCATTTCTATTGGAGAAATCACACATTTTTTTCTCTAATAATAT


invisible?    
Gene introns: 0  

>17025 212 794     2p21    chr2:47025706-47025917 BLAT!
TTCTCTCCTTCTGTCCATTTCACTATGGTCTCAGTTTGCAATGGGAGGAGAGTCATCACA
CTCTCAGCTGAGCCGAGTTTCCTCCAGGGCTTTCCATCAGGGCTGGAGCCTTTGCCAACC
ATCCCGCAAATTCCATATTCACTAACAAAGCTGGGTCCTTGGACGTTGTTATGAGCACCT
GCAATGGGAGAAGATGGAGGTAATGGGGAGTG


invisible?    
Gene introns: 0  

>15544 214 793     4p15.33    chr4:11604297-11604510 BLAT!
GTAATGTTCAAAATAGGAGGATGACTAATAAGGTATTTATGATGCCTTTAGTAAGGTAAG
ACCCTTAGTAAGGTATTGATGATGTAAATACCTAGTGAGATGTTTACAATGCCCTTGCAT
GAATGTGGGATAAAAATCCAGCAGCTTCATGGTGAATCATCTTCAGAAAGTTTATGTTTA
GAGCTAACTTCAATTGTCCCATATATTGAAGGAC


invisible?    
Gene introns: 0  

>1369 166 790     5q23.2    chr5:122955592-122955427 BLAT!
CAAAAACTTCTTTATGACTACTAGCTTTTCAGCAAGAATACTTGCTTGGAGACATGAGGA
CACTGTGGCAACACCAACAGTTAATTAAAAAACAAGGCAAATGATTTCAAGTAGCTTTGC
TTGGCTTTTGGTGAGTCAACAAATGTTACCAATACTGCCCCGTTGT


invisible?    
Gene introns: 0  

>2801 220 790     5q21.1    chr5:101074230-101074011 BLAT!
TAGAATATTTAAAACTCTAAAATGTATTTTCTTTCATTAAAATAGATTCATTTAAATCTT
CCTTCTTTGCAAATAGGTTTGCTGCTGAATTCTATTCCTTATTAATAGACGGAGGGCTCA
ATCACATTTTGCATCAATGATTATTTAGTAACAGCTGATAGTTTATATTCATTCTGATGA
TATCCAATACCGGATTCCCACTATTCCCATGGGTTGATTA


invisible?    
Gene introns: 0  

>28540 152 790     8q12.1    chr8:55857369-55857520 BLAT!
CTTGCTGGGCACAAAAAGTGTTGAGTGCACAAGAAATGATATAACTGCACAGACTTGGCT
GGGCACAGTGGCTCACACCTATAATCCCAGCACTTCGGGAGGCTCAGGTGGGTAGATCAC
TTGAGGTCAGGAGTTCAAGACCAGCCTGGCCA


invisible?    
Gene introns: 0  

>30713 202 790     2q31.3    chr2:181746122-181746323 BLAT!
GATAAACAATTCATAATGATAAAAGAGGTAATTCACCAATAACATGTTAATTCTAACTTT
TTGTGCACCTAGTAACAAAGCCTCAATGTTCATGAGGTAAAAACTAACAGAAGTAAAGAG
AAATTGTGACTAACTCACAATTATATTTGGAGATTGAAATACCTCTCATTCAGTAATTGA
AAGAAAAATATATAGATAAAAT


invisible?    
Gene introns: 0  

>21249 176 789     5q23.2    chr5:123142653-123142477 BLAT!
AAAAACCTCAGCAAATAGTTTTTTGTTTTCAATAGTTATTTCTATCATCATCAACACATA
CCAACACAAAAATCACTCTTTCATCTTAAAAAAAGAAACACTTAATGAGCACCTACTATA
TGCCAGGGGCAAAGTCTATATTCTGGAAAAACAGAGATGAGTAAAATATAGTTCCT


invisible?    
Gene introns: 0  

>7166 175 787     1q24.2    chr1:169468961-169469135 BLAT!
AAATGAGCCCAAGGGCTGCTAGACCTAAATAGCCACTCTATTCCCCACCCTCTGTCTCTC
TCCACCTTTCCCCACCCATTTTATTCTTTGATCTCAACTTCTGCTCTCCCCCTTGCTCAT
TTGGCTTCAGCCACCTGGTTCTCCTTGTCAATCCTGGATCACTACCTGCATATTT


invisible?    
Gene introns: 0  

>8594 111 787     6p24.3    chr6:7517373-7517441 BLAT!
TTAAATTTTTTACTCTCTCTACAAGGTTTTTTCCTACCCCGCGTACTGCTTGTCATATAT
CTCCTGAAAGATGTCTTTAAAACGCCCATCATATTTCTTCAGAATAGTGTT


invisible?    
Gene introns: 0  

>26793 233 785     1p31.1    chr1:74300348-74300580 BLAT!
CAATAAAACTCTGAACCAACAGGCTTTGCTAAGATTTCCCTTAGCTTCCTACCCCTAGCT
CATACCCTTTTCTCCTATCATATTTTTCTATAACTTGCTATTCTTCAGTCTTCATATAAA
AATGCTCGATTAACTATATCCTGTGATCTTTATTTCCTTAGGAAGGCTCCCATGCCATGT
TAAACATATTAAATACATTTGTGTTATTTCCTTTTGTTAATCTTTCTTTCGTT


invisible?    
Gene introns: 0  

>6918 173 784     14q32.11    chr14:90925705-90925533 BLAT!
AGTCAGTAATGGGGGGCATCTAGCAGTTTCTGAGTCTTAACCTTCAAGGTCTAGTGCAAG
ACTTCCCTGTGACACCAGTCCTGGAGGATATCTTACATCATACATCACTCAGAATCACAG
TTTACTATATATTCATTGTTAAACACTCATAGTTTTATACAATAATAATAATA


invisible?    
Gene introns: 0  

>13163 213 784     4p14    chr4:40415337-40415549 BLAT!
ATGGTCAATGCTGAGGGCTGACGGACATCTGGCTGGCAGCCACCCTTCCCTGAATCCCAC
TGATGTCATGTGTGAGGAGTCTCAGAGCACCATGATTTAAGGCAAATGAAAAATACATCC
ATTTATATTTTCCAAAAGTAATATACTGTCTTATGGTAAAATGAGTCCTACTTTAAAATT
CATAGTTTTACTCCACCTCCTTATATCCAACTA


invisible?    
Gene introns: 0  

>12107 184 783     4q22.1    chr4:92054718-92054535 BLAT!
ATCAAAAATCAAAAGTTTATACCAATGCCTCTAAGTCCAGTTCAATACCAGAGGCGTCAA
TCTACCTTCACTACTTCCATATTTTAAAATTTCTTCTCTAACAGGGAGTAATCAGATGCC
CATTATGGTAAATATATTTACTCATTCGCTGACTTCCTATGTGATCAATATCTGACTTCA
TGAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>22470 173 783     14q22.1    chr14:52755749-52755577 BLAT!
TTTCATCTTTTTATCTTGCTCTATTAACCACTTCAGAACTAGATGTCCTGCAGGATGTTC
TGCAATGTGAAGCTCTCCGTCCTTGCCACCAGGATGCAGTCCTGTTGCTGCCAAGCTGGC
GATGGCATTCATGGTAGGCTGAACGTCTCCAGTGGCAGATCCCAGAATGTCAG


invisible?    
Gene introns: 0  

>15261 195 782     7q21.11    chr7:84421903-84422097 BLAT!
TTTCTTAGACATGATTAAAGGAGAAACTGAAGATGGATTGTGGTTTAGAAGTGTCAGAGA
ATTATTAATATATTTGACTAGTAGGAAATACTACCACAAGAACAGAAAACCGGATACCGC
ATGTTCTTACTCATAAGTGGGAGTTGAAAAATGAGAACACATGGATGCAAGGAGGGGAAT
ACCACACACTGGGGG


invisible?    
Gene introns: 0  

>16222 178 780     21q21.3    chr21:31471653-31471476 BLAT!
CACTCTGGCCAAATCTTGAAGTATCTTGTTCCAACAAAGTTAACCTGAGCGTAGGTGAAG
AATTAAAAACAGAAAGATATCTAGGAGCTAGGCCATAAGGAGGAATGCAGTCTCAGGAAT
TGCATGGTTGAGTCCAAGCTTTCCAGAGACAAGGTTACTAGGCAGGTTATAAGGCATA


invisible?    
Gene introns: 0  

>2889 279 779     16p11.2    chr16:33887656-33887749 BLAT!
ACTCCTTTCTTTTGACAGGGTCTCCCTCTGTCACACAGGCTGTAGCAAATTGGCACAATC
TCTGCACCCATGTCATTCCATTCTATTCCATTCAACTCCCTTCCGCTCCACTCCATTCCA
CTCAATTCAGTGCCAGTCCCATCCAGTGCATTACACTCCATTCCAGTAAATTCCACTCCA
CTCCACTCCATTCCATTCCACTCCATTCCTTTCCATTCTACTCCACTTCGTTCCACTCCA
CTCCACTCCACTAGATTCTACTCCTCTCCACTCCATTCC


invisible?    
Gene introns: 0  

Shown 961-990 from 3142 sequences on 33 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs