Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 991-1020 from 3142 sequences on 34 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>16358 170 778     1p33    chr1:47195768-47195937 BLAT!
GGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCAGATCTCTCTGCAGAAACCCTACA
GGCCAGAAGAGAGTGGGGGCCAATATTCAATATTCTTAAAAGAATTTTCAACTCAGAAAT
TCCATATCCAGCCAAACTAAACTTCACAAGCGAAGGAGAAATAAAAACCT


invisible?    
Gene introns: 0  

>29038 145 778     5q14.2    chr5:82270895-82271039 BLAT!
TTCCCACTCATGTTGTCCTCTCTGGCTGCTCCCCCAAGGAAGAATTAGACCCCTCTTAGC
ATTGGTATGCCGGTATAAATCCCACAGCAGGATCTGCCCTAAGCCATATGAGGTAGCCAC
AGAACCGTGGAGAGGACCCACTCAC


invisible?    
Gene introns: 0  

>30678 241 778     14q22.2    chr14:54458681-54458471 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGCGGCCTGGACCTTGCAGCCGCAATGGATTCAA
GTTCGAAATATGGCAACTTTGAAAGATATCACCAGGAGACTAAAGTCCATCAAAAACATC
CAGAAAATTACCAAGTCTATGAAAATGGTAGCGGCAGCAAAATATGCCCGAGCTGAGAGA
GAGCTGAAACCAGCTCGAATATATGGATTGGGATCTTTAGCTCTGTATGAAAAAGCTGAT
A


invisible?    
Gene introns: 0  

>7821 185 777     3p12.3    chr3:74217352-74217168 BLAT!
CAGGCTCACCTGGGTGGATCTTCTAATTTTGGCTTGGCTCACTCAGGCATGTGGAGTTGG
CAGGGGGTCAGCTGCATTAGACTGGGCTTGGATGGGAACACTCAGCATTGCTCCACATGT
CACTCATCTTTCTCCTTAGAGCAGTGGGCCAGCACAGGAACATCCTTCTCTTGACAATGG
CAGAA


invisible?    
Gene introns: 0  

>16654 244 777     11p13    chr11:34836478-34836722 BLAT!
TGTGCACCCAAAACTGAAGCCCCCAAGTATGTAAAGCAAAGATTAACAGATATAAAGGGA
GAGATAGGCTGCAATACAATAATAGTAGGGGACCTCAACACCCCACTCTCAGTAATGGGT
AGGTCATCCAGGCAGAAAACAAAGAAGCATCAAAGTTAACTACATATTACACCAATAGGT
TTAGCTGACATTTACAGAACATTTGACATAACTGTTGCAAAAAACCACATTCTTTTCATC
CCCA


invisible?    
Gene introns: 0  

>27534 181 777     7p11.2    chr7:57865076-57865256 BLAT!
TCTTCCCTTCTTGTAAGATTTACTTTTCCTTAAAAAGGGCCCTTTTCATCCACCCACTCT
TTTGCCCTTCCCAGAAGTTGGTTAATGGGCACAAAAATACAGTTAGATGGAAGGAACAGA
AGAATTTCTAGTGCTCAATAACACAGTAGGGTGACGATCATTAACAATAACATATATTTC
A


invisible?    
Gene introns: 0  

>9972 152 775     18p11.31    chr18:4498306-4498457 BLAT!
GTAGGTTTGAAATTCCAGGATAGGCCGGGTGCGGTGGCTCACGCCTATAATCCCAGGACT
TTGGGAGGCCAAGGCGGGCGGATCATGAGGTCAGGAGATCGAAACCATCCTGACTAACAC
GGTGAAACCCTGTCTCTACTAAAAATACAAAA


invisible?    
Gene introns: 0  

>29092 275 775     4p16.1    chr4:8319670-8319500 BLAT!
AAAAAAAATTTTTTGTTGTTTGTTTTGAGAACGGGTCTCACTCCATCACCCAGGCTGGAG
TGCAGTGACACGATCACGGCTCACTGCAGACTTGACCTCCTGGGCTCAAGTGATCCTCCC
ACCTCAGCCTCCCGAGTAACTGGGACTACAGGCTCATGCTTAATTTTTAAATCTTTTTGT
AGAGACAAGATCTCCCTATATTATCCGGACTGGTCTCCAACTCCTGGGCTCAGGTGATCC
TCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAG


invisible?    
Gene introns: 0  

>25080 181 774     11q13.3    chr11:68521773-68521593 BLAT!
CTTGCGAACAACCAGATCTCACAGGAACTCACGCACTCTATGGTGAGGACAGTAGCAAGA
GGGATGGTGCTGTTCATGAGAAATGCACGCCCATGATCCAGTCACTTCCCATCAGGCCCC
ACCTCCAACATTAGGGATTACCACTGAACCTGAGATTTGGGTGGGGACACACATCCAAAC
C


invisible?    
Gene introns: 0  

>29990 202 773     6q23.3    chr6:138742106-138741905 BLAT!
AAAAAAGTCCTAATAAATGCTTCTCATGTGCTAGGTAAAGACAAGGAGGCCCAAAGATAG
AAAACGTGGTTGAGCTATCAGTGAGGGGCATGATCCTACTGCCAGTTTAGATTCTTCAAG
AAGTAGACAGTTAGAATACCAAAGGATTTATTATTGGAGTAAGCACCTTTGAAAGGAAAA
GAGGAAGCAGGACGAGGCAGGG


invisible?    
Gene introns: 0  

>18378 193 772     3q28    chr3:191463357-191463549 BLAT!
ACAAGTTGGTCTTCTGGGACTGAACAAAAATGGGTTGAAGGGGGCAGTGGTGGAAGTAAA
AATCATCCTTTGCTCTCACCGAAGTAGAGACAGCAGTGGCGTGTTATCCTAAACCTGGAA
CTGGGATCAGAAGATATGAATTCAAGGCACTGGCTCTGCAACCATTGTGCTTGTTGACAT
TGTGAAAATTATA


invisible?    
Gene introns: 0  

>21173 218 772     6p25.3    chr6:374952-375169 BLAT!
AAACTTTACAGCAGCAACTGCTGTCAGCAAGAGCCATGGGTGGACACTGCAACCACTGGG
CAAGGCTTTGAGGAGAAGCCGGACATTCTCATTGTCGCAGCTGATGGAGAAATCCTGCAA
ACACCACCTTAACCAAGTGATCCAGGGAAACAGCACCACTCCTAGGACCACGGACATCAC
ATCCCCCAGACACGTGGCAGTGAGGAGGACACATGCCC


invisible?    
Gene introns: 0  

>24133 214 772     6q24.1    chr6:141619375-141619162 BLAT!
AGTGTGCCCTGAAGTTAATATTTCAGGAGAGACTTTCAGCAGAAGGTCACTTGGGAAGAG
TGAAACTATCATAGACATCAGAATGTGTGTGTATTTTGAGTAATAGCACTGGGGATTTGA
GGACTCATCCATGACATACAGGTGATCTTCACATTAACACATTCCCCAAAATTTAAATCT
ATGAGGTGAGAAACTAAAAAACTAAATTAAAATC


invisible?    
Gene introns: 0  

>10342 106 771     1p33    chr1:47195806-47195702 BLAT!
TCTGCTGTTAGTCTGATGGGCTTCCCTTTGTGGGTAACCGGACCTTTCTCTCTGGCTGCG
TTTAACATTTTTCCTTCATTTCAACCTTGGTGAATCTGACGATTAT


invisible?    
Gene introns: 0  

>14630 163 770     8q24.22    chr8:134922565-134922403 BLAT!
GAAACTGAGGACAGAAAGGTAAAGTCCTTTGTTGAGTAACCAGTAGAACTGGAATCTCGA
CAGGGGCCTACCTGAGTCTCATCATAGCCATGTTTGCCCTTTGTGATCACCCACCTTCTA
ATCTATGACATGAAGACATTCCACTTGAAAACCTAGAAAGAGG


invisible?    
Gene introns: 0  

>29967 190 770     21q21.3    chr21:29816125-29816314 BLAT!
AGCTTGTGAAAAATACATTGTCATGCCCTTAACACTGGATTGGAAAAACTGCACCAAAAT
CGCTTGAAGGAAAACCGACTGAACAAAGTTTCACAATAATGTCACTCCTACAATGCATCA
TCTATGCAAAACAAGATATCAAATTCTATAACTTTCCAGCACACTAAATTATCTCCCATT
TCCTCTACTT


invisible?    
Gene introns: 0  

>31890 177 770     8q23.3    chr8:116209517-116209693 BLAT!
GACCGAGAAGAAGTTCCAAAGCACTTCCCAAAGCCAAACTTGCACCAAAGAAAGGTCATG
GTCACTGTTTGGTGGTCTGTTGCTGGTCTGATCCACTACAGCTTTCTGAATCCCAATGCA
ACTATTACATCTGAAAAGTATGCTCAGCAAATCAATGAGATGCACCAAAAACTGCAA


invisible?    
Gene introns: 0  

>15282 171 769     1p21.1    chr1:106436077-106435907 BLAT!
CAGACAGGTCAACCTTCACACATCTCCCCTGAAACCAAAGGGCTTTTTTCAAACAATGGT
CAACCATTGCCATTGCATCTTCTCTTGTCTCCATCTCAATAAAAGCCTGACTTTTCATCC
TCATCAATATGTAATTCTTTATTTTCCCATAAGGCTCAGCAAGCTTGAGAA


invisible?    
Gene introns: 0  

>16756 178 769     3p22.3    chr3:35933455-35933632 BLAT!
GGAAGCCCACCCTTCCCAATAAAAACAATAAATATCACATACATGGCAGGGAGTGCATAA
ATTTTTGTCCTCATCACAAAGTTGAAAGGTTTAAAAGTGATGATTTCTATCATATTCTTA
CTTGTCTGTTTGGTCCATGCAAAGCTAAATGAGTTTGGAAAACTATTGTGAATGATTA


invisible?    
Gene introns: 0  

>24604 161 769     3p21.1    chr3:54072664-54072569 BLAT!
GGTTTTCACGTGCCCAGGATGGTTGAGAACATCTAAAGACAACATTATCCATTCATCAAG
AACATCTGCCATCGTTGTGTAACTTGTCTGGACCCAAGGGCTGGACTTTGCATTTCTCTG
TTATGCTCCAGGTTGCCTAACTTGACCTGGCTTTGCAGACT


invisible?    
Gene introns: 0  

>7954 175 768     12q21.2    chr12:76431454-76431280 BLAT!
GCGAGGACAAGGAGATGTATGACTGGCACTCGCTCAAGGTTGAGTGGAACGAGTCAAAAT
AAGTAGGACCCATTCTGTGGAGGGCTTGTCATGCAAGGGTAAGGAATTGGAATGTATACA
ATTGGAGGCGAATAGAAGTTTTCTGTCATGTTTTAAGAGTAAAACTGAAGGCCAT


invisible?    
Gene introns: 0  

>11894 202 768     3p12.1    chr3:84414376-84414175 BLAT!
AGTAGCATGTTCTAACCCAAGGCAAGGAAGCTAAGAACCTTGATAAAAGGTTAGATGAAT
TGCTAACTAGAATAACCAGTTTAGAGAAGAATATAAAAGACCGACAGAGCTGAAAAACAC
AGCACGAGAACTTTGTGAAGCATGCACTAGTATCAATATCTAAATCAGTCAAGCGGAGGA
AAGGATATTAGAGATTGAAGAT


invisible?    
Gene introns: 0  

>15403 254 767     10q25.1    chr10:107385349-107385602 BLAT!
TTATCCACTCTACCTGACGGCTTGAGAGTAGGGGCCATGTCATAATTCTTGAATTCCTTT
GATTTAGCACATAGTAAATTTTTCATATACACCTGCTCTGTATACAGAGATCTGTCAATA
TAACTAAGGCATGGAAATTTGCTAATTATATTGTGTGTAATGAAGAGGAAAAGACAAGTT
ATGCATTGGCATGGAGGCAAAATAAGGATTTCAGATTTTATCTTTAATGTATTGAGAAAA
AAATCTTACAGATT


invisible?    
Gene introns: 0  

>3138 201 766     9q22.32    chr9:97444662-97444462 BLAT!
TCCATGGACCAGCAGCATCAGCATCACCTGGAAATTTGTTAGGGCTGCAAATTCTCTGGC
CCCTCTTGAGACCTACTGAATCAGAAATGATGGGGTAGAGCCCAGCAATCCATGGTTTAA
TAAGCCATCTAGGTGATTCTGATCATGTTTAAGAATCCCTGCTAGATCATACAAAGGATA
TTTAATGATGGAAATACTATC


invisible?    
Gene introns: 0  

>4059 185 766     4p15.2    chr4:24070086-24070270 BLAT!
GATGCACATTACAATGGGCTTCAGGGAATTGCAAACTCATTCTGTATGACTGGAGCATAG
TAGGGGATGAGGGATAAGAGCCAAGGCTGGGAAAATATGTATGGCTCAGCCCACACCACA
TTCAGGGTTTGTGTGTGTATATGTGTGCACATGTGTTTATATTGTGGAAGGTGTTGGTGT
CAGAA


invisible?    
Gene introns: 0  

>7871 175 766     6q16.1    chr6:93102084-93101910 BLAT!
AGTGATGGAGGTGACTTTCAGCGGGGTGGATGGGGAGCCAGAATGTAGGGATGGAGTGGG
GAGGTGATCTTCCCCTGGAGTCAGGCTGCCCAGTTGTGGATTCCTCTCCAACCACCCCCA
GCCAAACTCCTCTAGGCATTCGACTGTTCCTTCTCTCTTTTTCTGCGGCTTCATT


invisible?    
Gene introns: 0  

>27996 179 766     13q22.1    chr13:73931280-73931102 BLAT!
TGTTTGTAGGCAATTTCACCCACTACCATGTTTCAATAACTATCTATTAGCTGCTGATAA
CCAAATTTATATCTCCAGTTGAATTATTTCTCTCTTGAGCTACAGACATGTCTTTTGGAC
ATCACCATTTAAATGTCCTGCAAGCAACTAAAAGAATCTATATGTCAAAACTTGGACTC


invisible?    
Gene introns: 0  

>3886 167 765     8q21.11    chr8:73974931-73975097 BLAT!
TCCCCGCAAAATTCATATGTTCAAACCTTTATCTCAAATATGATGGAACTTGGAGTTGGA
GATGGGCCTTTGGGAGGTAATTAAGTCATGAGGATAGAGCCCTGATGATAAAATTAGTGC
CCTTATAAGAAGGGACATGAAAAAGCTTTCCGTGCTTGCTCTCCTCT


invisible?    
Gene introns: 0  

>24925 211 765     18q22.2    chr18:67026866-67027076 BLAT!
AATCTCATCTTGAATTATAACCCCCACAATTCCCACATGTCATGGGAGGAATCTGGTGGG
AGGTGATTGAATTATGGAGGTGAGTCTTTCCTGCACTGTTCTTGTGATAGTGAATGAGTC
TCACAAGATCTGATGGTTGTAAAAATGGGAGTTTCCCTACACAAGCTCTCTCCTTCCCTG
CCACCATCCACATAAGATGTGATTTGCTCCT


invisible?    
Gene introns: 0  

>27855 272 764     3q24    chr3:147326316-147326045 BLAT!
TCCTAACCTACTAAATTCTTTTTTCCAAGAACAACGACTTCCTTTACACATCTATTTGCT
TCCATGTTTCTAAATATATGCCTTAGACTTACATTTCATGATCTATCAATTTTATAATTT
GTGTATTGACTGTGTTATGGCATCATCTTATATAAACACCTTCTATATCCCCTCTTTTGT
AATTACATACTTCTTAAGATTTACATGTTGTGAGTTATATACATATTGTTCCTTGCTGAG
TCCAATGATAGTCAAACAAGCTATTCTTTTTT


invisible?    
Gene introns: 0  

Shown 991-1020 from 3142 sequences on 34 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs