Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1021-1050 from 3142 sequences on 35 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>31816 226 764     13q33.2    chr13:104963599-104963374 BLAT!
TGAGACTTCCTTACAGAGAGCAGATTCAGAGACTTGTCAGGGAACTTCCTTCATTGCAAG
GGCAGGGGGCCCTCCCCCTGCCTGCATAGCACATTTCATATGGCCTAGTGACTCTCGGGT
ATTATGCAGTATTACCTGAGGCTCCATCACTCTATAATTTGATTTTGGTGGTGGGAACAA
TGGGGAGACTGATGTGTCATCTAACTTTCATGTAGAACAGATGAGG


invisible?    
Gene introns: 0  

>30631 188 763     15q14    chr15:39012128-39012315 BLAT!
ATATTAGGATTCTACTAATGACTACCTCTACTGGGGAGCTATTTGTAAAGAAAGCAAGAA
AGAAACAGATAAGTAACATGGTTTATCAAAAAATCAGCACCAGTCATTTGAAAAAGGAAT
GCAAACTGCTGCTACTTTTGTGCCAGGCATCTTAATTCTCTGGGGTTAGGTCTTACCTGA
GTAATGTG


invisible?    
Gene introns: 0  

>20267 163 762     3q26.31    chr3:175289260-175289098 BLAT!
GGAGGTTGGCAGCAAATTTGTGCAGGTCAATTAATTTTTAAAATTTATTTACAAGGCTGA
GTAAATTCATGTTAAGAATTTCATCCAAGGAGTTCAAAATGCCTCATATTTAATGTTTGA
TAACAAGCATTTTTATTCCAGTTCATAACAGGGGCAAGTTCAG


invisible?    
Gene introns: NAALADL2 (174577110 - 175523428)  

>22073 141 762     1p31.1    chr1:70865294-70865434 BLAT!
TTGAGACATAGTCTTGCTGTGTCCAGGCTGGAGTGCAGTGTGCGGTGGGGCAATCTTGGC
TTACTGCAAAATCCGCCTCCCAAATTCAAGTGATTCTCATGCCTCAGCCTCCTGAATAGC
TGGGATTACAGGCATGCACCA


invisible?    
Gene introns: 0  

>23635 191 762     3q24    chr3:145776372-145776562 BLAT!
AATACACAGTTTATCCATTGGCTCAAAATAGATGTTAACAGATTTGAAAGAAAAAGTCAA
AGCAAGGCAGGCATCGGTGTTAACTTGTTACTTGACCTACTGGAGGCCCTTAAGCACAGA
TAAGATTAGAACTCAGAGTTGAAAGCAAGACTGAATCTCTTGGTGAAGTTCTAATGTATA
CATAGAATAGA


invisible?    
Gene introns: 0  

>15989 124 760     17q25.3    chr17:80458817-80458940 BLAT!
TTTTGAGAGGGAGTCTTACTCTGTCGCCCAAGCTGGAGTGCAGTGGTGTGATCTCGGCTC
ACTGCAACTTCCACCTCCCAGGTTGAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTG
GGAT


invisible?    
Gene introns: 0  

>21764 201 760     8q21.12    chr8:79287925-79288125 BLAT!
CGTTCAACATGAGGAGAACCTAGAGTTACCGGGGAACATCCCCCTCCTGAAATAACTGTG
TGAAACACAGAGACTTCCAAAATTTTCCCAAGTTCCCACTGAATGGGCTATAAGCGATTA
TAATTATTATTTCTTAAGAACAGTAGATAAAAGGATTCTGTTGTATGCTACAATCCTTAA
TGATTAAACGTGTTTACCTTC


invisible?    
Gene introns: 0  

>24211 192 760     6q14.1    chr6:77948097-77947906 BLAT!
AAGTAGAAGTTCCCTGGAATTTAGTGGGATTTATTTCCTACCTTCTGGCACAAAAATGTC
TCACCAATAAGTCTAGTATGTTTGCTACTTCTTGCTCACTAGATCCAGTCAGCATAATGT
CATCAATGTATTGGACCAGTTTGATATCTTATGGAAGTGAAAAGTGAATAAGATTATGAC
ACAAAGCCGGAG


invisible?    
Gene introns: 0  

>16551 176 759     1q23.3    chr1:162929913-162930087 BLAT!
CCCCAGCCGAGTCTTTTAAGTTTTCTTATTCAGCCTTTCGTTATTTAAAGGAAGAAGCTA
ATCAAAATAATAAGATACACGATCAGAATTACAGTATCATTTCCTGTTCTCTCTTTTCTC
TGTTAGCACCTTCTGAAATAAGGTGGAATTTTTAGGTCTATACTGAACATTTCCTG


invisible?    
Gene introns: 0  

>19587 197 758     18p11.31    chr18:6624878-6624682 BLAT!
TTCCCTGCTCTGCCTTCCCCCACCTCTTTATTCGTCAGAGCTGAAATATCATAGTGGCTA
GAATTCCATTCGGTTGATAACATTTGCTCCTAGTGGGTGTTTACCACATGATGATCAAAT
ATTATTGCCAATAGAACTCGATGACTTTGAAAAGGTTTGCAAATCTAGCTGCAGTATTTG
AAATTCAAAAAGAGACA


invisible?    
Gene introns: 0  

>21030 200 758     13q31.1    chr13:79484008-79483809 BLAT!
TTGTTCTGAAGAAGTAAGTGATTTGCTTCATCATCAAAGCCCCACTGACAAATTGCTAGG
TTAGCACCAGTCTCTTTAATTTGTTGAATCATCTCTTCAAATTTCTCCTTTTCGTATTTC
TGAAGGGCTTTATAATCTTCGACAGAGGTCACATCCAGCTTATGCTTTGTTTTTGGTTTG
GGTGGTTCAAATGGACATGT


invisible?    
Gene introns: 0  

>30501 149 758     3p13    chr3:72349273-72349125 BLAT!
ATTGGCCTTCTGACTCAGCTTTGATTTGAAGAAAGGGTTCCATGACTCAAAAGAGTTTGA
TGAGGGATGACCTCTCGTGTTCCATCTGGCAGAAGGTAGAGCCACACCCAGTTGGGAGTT
TCCCTGATACTAGGAAGAGCGACATCTCC


invisible?    
Gene introns: 0  

>18492 148 757     17q22    chr17:51087101-51087248 BLAT!
AAAGCACAGCTACCCCTTAGTCAATCTGGGGAGAAAAAAGAAAAAGAAAAGAACTGCAAA
AAGCACTTTGGAGAGGGACTGGTCATTAAATGGATAGGGTTCTATTGCTGAATATGCTGG
GAAGTTTGCCTTTACTACATTGAGCTTA


invisible?    
Gene introns: 0  

>6427 195 754     2q32.3    chr2:194369640-194369446 BLAT!
ATTTTTTAAAAAAGCAAAAGTTTCTCTTTTTTTCCTTTATCTTCATATGACTTATTAAGC
CATTTAATAATGAAGGTGGTGATACCGTCTCTCACAGACCAATCGAAATCCACTACTACA
TTGAAGCTCCTTGCTGAGGTAATTTAGTTCTGTTATTCAGAAACCCAATACACATATCAG
AATGAATTTTCTATC


invisible?    
Gene introns: 0  

>16470 113 752     8q24.13    chr8:127043943-127043831 BLAT!
TATTTTTAATTGACAAATAATAATTATATATATTTATGGGATACAATGTGGTGTTTCAAT
ATATGCACACATTGTGGAGTGACCAAATCAGACATTTTGATTATCATGACAGG


invisible?    
Gene introns: 0  

>18971 199 752     4q32.3    chr4:166576092-166576290 BLAT!
CCAGAGAGCTAAGAACACAGCAACTTCAATAGCTTGCAAAGGGCTGGAAGCTATTGCAAG
CTTTAATTTCAACTAACTGGATGGAGGAATATCAGGAGACATTTGGGATTTCAGTAGAAG
TTTCAGGCAGCCATCACTTAGGAATAGGGCTAACGTATCCCTAGAGTAAAGGCAACTCTA
GACCATGCTAACAATGTTT


invisible?    
Gene introns: 0  

>26642 171 751     12p13.31    chr12:8787258-8787403 BLAT!
GTGGGTTGGGGACCCGTACGCGGGGATTGCAGGTGCTGATATCAACATGTTAGCCGCTTG
CAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACT
TGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGG


invisible?    
Gene introns: 0  

>16833 232 749     14q21.1    chr14:41354230-41353999 BLAT!
GGAAAATCAGTCTGACTTATTTTCCTCATCTCCTCTCAAAAGTATACTATATATATTGCC
TGGAATTATTACATGCCAAACTTAGAGCTTGTTTTTGTTTCTTAAAATGGTAGTTAATAA
ATAACCTTAATGAGCAAACTAAATAGGAAAAAAGTAAATACTTTCAATACCTTCTCAAAA
CCAAAGCAAATATTACTTCAATATTGCAAATTACCCCAATAACGCAAACATT


invisible?    
Gene introns: 0  

>4016 181 748     2q23.3    chr2:150742530-150742350 BLAT!
ACAGATTAGAGTGAGGTGAGACGATTTAAGGAATCCCATCAGGAACAAATTGTGGAAGTC
CAAGAGATAGGATGGTAACTTGCACTGCAGTAATGGTGTGGAGATGGGGAGAAAATGATG
GGCTTGAGAGGAAAAAAGGGAATATCGCCCTCCTCCCCGACCACATTCCAGGCATGTGCA
T


invisible?    
Gene introns: 0  

>4842 202 747     12q24.22    chr12:117081313-117081112 BLAT!
GAAAGTTTTTATATGAGACAAGAGATGACTTGGCTGAGAGCTACGAATGAAATGCCAAAA
TATTTCTAGAAATCGTTGCTGGCCTAGAGTGCTGAATCTTCACTTAACATAGTGATTGAA
GTTGTGATATGGATACATTTAAAAATATTCCCTGTTTGAGGAATTATACCTGGAAGCCAC
CCCTCAAAGAAAGCCAGCAGGA


invisible?    
Gene introns: 0  

>9142 181 747     11p12    chr11:38078715-38078895 BLAT!
TGCCTAGGTTGTCGTCCAGGGTTTTTATAGTTTTGGGTTTTGCATTTAAATCTTTTATTC
ATCTTGAGTTGCATTTTTGCATGGTATGAGGAAGGGGTCCAGTTTCAATCATCTGTATAT
AGTTAGCCATTTATCCCAGCACCATTTATTAAATAGGGAATACTTTCCCCATTGATATTG
T


invisible?    
Gene introns: 0  

>29537 192 747     2q31.1    chr2:172142280-172142089 BLAT!
AGTCAGCCAGATCTGGTTCATTCTTCAACAAATCTTTATTTAGCATCTACTATATGCCAG
GCGCTATTCTTGGTGCCAGATGCTGCCTACATGAAGCTCACATTTTAATGTGGGGACCAA
TACTAGTTTGTGGCCTTGGGCAAATCATTTAGCCCCTCTAAGCTTGTTTTTTCCACCTGT
AAAATGGACATT


invisible?    
Gene introns: 0  

>2496 175 745     5q33.2    chr5:153939787-153939961 BLAT!
ACATGAAATTAAGGCCATTCTTTACACGTTCATCTCCCATAAGCAATCTATTATCATATG
ATTCTTGTTCTTTAAGATATTGCTGCATCAATTCTTCTTGTTTCTTCTTATCATATGATA
TTTTCTGTTCTGCCATCCATACTTTTTTGATATTGGATTTGGAGGCAGGATGAAA


invisible?    
Gene introns: 0  

>21587 232 745     2q36.1    chr2:222671866-222672097 BLAT!
TTCCCTCCACAAAAAGCTCTTACCTGACATGATAGAGATGAGGCCTAACTATGGCCCTAA
AGGAGCTGAAGAGACTTTATGTCTAGAGAATGTTTGGTTGAATCTGGAGCTAGAGGACAA
GATTAATATCTTCGACTTCTGAAGGTCAGGGAATAAAACTGGGAGAAAGTGATTTTTGCT
GGGTGTGGTGGCTCACACCTGTAATCCCAGGACTTTGGGAGGTTGAGGCAGG


invisible?    
Gene introns: 0  

>23456 190 745     7q35    chr7:144593924-144593735 BLAT!
TAGTCACCATGCAATATGTTAGACCTTTAGGACTTCATCTTATGACTGAAAGATTGCACC
CTCTGACCAATATCACTCTTTCCCCCACTCCATATCCAGCCCCAAGTAACTACTATTCTA
TTATTACCATAAGTTCAACTTTTTTAGATTCTACATATAAATGAGCTCACGCAGTATTTC
TATTTCTGTG


invisible?    
Gene introns: 0  

>14175 222 744     3q25.32    chr3:157252486-157252707 BLAT!
CCCATTAAGATGTCCATGTTCTCTGTCCACACAGCACCTGCAATGACAACTATTGTCCTT
CCAGGTCTCTGTCAAGTGTTCACAAAGGCCACCAGAGGGACATTCTCTTCTAATCACAGG
CGTCCTCCATCCAGTGAATCTCACCACTGTTTCTATCAGGTGCAATCCACATCATTTTGC
AGCTCCTGCACCATGCTGGGGTCTGGACAGACTGTGTTGTTG


invisible?    
Gene introns: 0  

>6911 182 743     10q21.1    chr10:54676377-54676558 BLAT!
GGTTGTATTTGCCTAAATATCTCCCGTCTCTTCTGTTTTCATAGGCACTTTTTATCACAA
GCTATTGACAGCACAGATTTTTATCTAATGCATATAAATGAATGTTTATGAGAAATTCCA
GAATGTTTTATAAGACACTACTTTTTAATAATACAAGGCTGTAAGGGTAAAAGTCTAAAT
TT


invisible?    
Gene introns: 0  

>21632 217 743     20q11.21    chr20:29873278-29873466 BLAT!
ATCAGCTCTTTCTTCAAAGCCAGCAGCTGGGACTGCTTCAGCTTTTGCTGGAGGAATTCA
GTCACTCGGTCCACATACCTTGGTGAGGCCAGGATCATAAACAGGTGTTGCAGCTGAAGA
CTGGTAAGCTTGCCAATCAGATCCTCCAGCACTGACACCATGGTAACCATCTTCTCTTTG
GTCTGGCCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>14287 208 742     10q22.2    chr10:76471510-76471714 BLAT!
GTCACACACACAAAAAGAATTATAGGCTGGCCATGGTGGCTCACACCTGTAACCCCAGAA
CTTTGGGAGGCCAAGGTGGGTGGATCACTTTAGCCCAGGAGTTCGAGACCAGCTGGGCAA
CATGATGAAACGCCATCTCTACAAAAAAAAAAATACAAAAATTAGCTGGGCATGGTTGTG
CATGCCTGTGATCCCAGATACTCGGGAG


invisible?    
Gene introns: 0  

>23260 103 742     Xp11.4    chrX:38339058-38338967 BLAT!
CCTGAACCTTTTTTACCAAGCCTTTCCTTTTCAATCTACTGTCTTTGAAATTTTCTGGCA
GGATCAGTGTGTCAATCTCCTCCAAGATCTTCATAAACTGCTC


invisible?    
Gene introns: 0  

Shown 1021-1050 from 3142 sequences on 35 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs