Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1051-1080 from 3142 sequences on 36 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>32958 169 742     7p14.1    chr7:39558879-39558711 BLAT!
GTTTAAAAAAGTGCCTGAGATTTCTACCATCAGCTCTTTCTTTTCTGAAAGTCAAGTCTA
CTAAAAAACCAGACCAATAGCTAAGTATCTTGCTCAATTTACATAAATCTCTTGCAATAC
GCATCACTACGGGCCATTTGTGATACAAGGTTTGCGCCAAGTAATTCAC


invisible?    
Gene introns: 0  

>2409 172 741     11q14.3    chr11:90830815-90830644 BLAT!
GATACCTTTGTTATTTGAAGTATCTATGAAGTTAAACGTAATGATACACATCAGCCAGAG
AAAAGAAGCTGAAATATTTGACATAATGCTAAATGAACTGCTTATATAAGGATTGGAAAT
ATTAGCAGTCCTAAGTAATTTCCAAGAGAGTTATTTGACAAAAACCTCTTGA


invisible?    
Gene introns: 0  

>20812 176 741     5q35.2    chr5:173300503-173300678 BLAT!
TGGGCTTCCTCTATTTGTGAAGCTCTGAGTGTGAAGCAATACTAAAACAGAATGAAAACC
ATTGTGCCGTATTTTAAATGTGTATATTCTTGATATATTGTGCACAGATATACTCTTGCC
ATTTATCATGTGACTCTTACAACAGTGTATCTGTGACTGTGTGTGACAGTGTTTAG


invisible?    
Gene introns: 0  

>22832 196 741     2q34    chr2:210043631-210043436 BLAT!
GCAGCTGCTGAGGTAACCGAGGATTTACTGAAGAGCCGCTCAGCTTCCTTAAACTTCCGG
TTCCTTCGATCATTTTTGCTATTGGAGTTTTTTTGGTTGGTCAGATACCGATCCCAGCCA
CGAATAATATTGCCATACATCTGAGTGTCTTCCAGGTAGCTTCCCTCAAAAGCATAGATC
TGTCGCTCCAAATTTG


invisible?    
Gene introns: 0  

>20255 190 735     Yq11.23    chrY:27168010-27168199 BLAT!
CGGGACAGAGGCTGGAGAGACACATCACCTAGCCGAAAAGACCAGAAATATGTAATAATA
TCCCCTGTTGACAGGGCCCAGGCAGAAGAGTCAAGTTATTATGATTCTGTCCCATTGACA
TGTAACAATAAACCCATGGAAAGGAATATGAGCCAAAAAGTCTCAACACCTGCATACTAT
GTCCAGTCGT


invisible?    
Gene introns: 0  

>21458 177 734     14q21.2    chr14:45228357-45228181 BLAT!
TATCTTTTCATCTATCAGTGGGCATTTAGGTTGTTGCTGTCTTTTGACTATTGTGAGTAA
TATTGTAATGATAGTGTGATGAACAGGGGCATGCAGATATCTCCTTTAGATAATGATTTC
ATTTCCTTTGGATATATCCCAGAAGTGAAATTGTTACACAAGATGAGTAAGTTCTGA


invisible?    
Gene introns: 0  

>24524 169 734     1p31.1    chr1:82648480-82648649 BLAT!
TAAGCCAAGCTTGTTTAACCCACGGCCCACAGGTTGCATGAAGCCCAGGACGGCTTTGAA
TGCAGCCCAACATAAATTCATAAACTTTCTTAAAACGTGAGTTTTTTGTATTTTTTTTAG
CTCATTAGCTATCATTAGAGTATGTTATGTGTGGCCCAAGACAAATCTT


invisible?    
Gene introns: 0  

>30340 212 734     11q14.3    chr11:92380711-92380500 BLAT!
GAATATCCTTGAAATATTTAACTTCTGCAGAAAAGTGCATGCTGTATCAGTTTAAAATAC
TATGTAATATTGATGTAGAGTTTTTCCAGTTATGACTAGACTCTTCATCCTAGCTTTCAA
AGACTCAATCCAGTGTCCACAATTCACCTTGTTCATCTTATTTTGAGCAATTATGTCATT
TGGAGTCCATTCCTCAAATGTTCTGTTGTCCA


invisible?    
Gene introns: FAT3 (92085261 - 92629635)  

>17877 170 733     9q31.1    chr9:103447710-103447879 BLAT!
GTAAAAAAATAAAAAAACTGGATAACTAGTCCCATGGCAGTATAAGAAAAAGACTATTCA
GTAGAAAGAATATTAGTGAAGTTGAAAAAACTGCCTTCCTTAGGCCGGGTGCAGTGTAAT
CCCAGCACTTTGGGAGGCTGAGATGGGCGGATCACGAGGTCAGGAGATCG


invisible?    
Gene introns: 0  

>25894 142 733     14q21.1    chr14:38104137-38104278 BLAT!
TTTTTTTTCCAGCAGTTCTACCCTAGAAGGATGAGTAAAGGAAGTTCTCTAAACAGAAAA
GATTAGAAAAAAGAATTCTTGGAGCACTAGGAAGAAAGAACATAATAAACAAAACTATGG
CTACATACAATAGATTTTCCTT


invisible?    
Gene introns: 0  

>31369 154 733     4p15.33    chr4:12350326-12350173 BLAT!
CCATTCATAGTAAGTTTACCCATCAGGAAACAGCTTCTCCAGAGTTCCGATTAATGTTTC
CTGGTAAACTTATAAGGAAAGGGATGGTAGGACAAACTAGAGCTGTTCATGTTGTAGTTG
ATCACAAGGCTGTAACTGATTCATCCTCCGCCTC


invisible?    
Gene introns: 0  

>915 129 731     3q26.1    chr3:161048242-161048370 BLAT!
AGTTTGCACTAATTTGTTAGACAATGAAGCTTCAGAGTGGAGTGATCAAAAGCACAGACT
AGGAGCCAGACTATCTATGTGGGTTCCACTGCCGGTCCTACCACTTACTAGCTGTGTAAC
CTTGGGGTT


invisible?    
Gene introns: 0  

>20820 182 731     4q13.1    chr4:61308246-61308065 BLAT!
AAACTTTCCAAATCTGGGGAAAGATATAAATATTCAGGTAAAAGAAGATCAAGGGCCTTC
AACTGGACTCAATCTAAACAAGACTATACCAAAACATGTTATAATCAAACTTTACAAATC
AAAGTCAAAGAGATAATCTTGAACACAGTAAGAAAAAAGAAACAAATCACATCCACATAG
AG


invisible?    
Gene introns: 0  

>3718 205 729     4q32.3    chr4:168190221-168190017 BLAT!
AATTCTTTTACTCAGGTGGCTCAATTAAAATATCTAAAGTCATGTTTCCATTAATAAATT
TCGGTTGAAATTTATGGCAAACACATAGAATTTAATCATAAATTAGGATGTTTTTGGAGA
ATGGATTTTGGGGGATATTAAATATAGAGCAAAAACTCAAAAATCATTCCTTTAAAGACA
ATGTTTTGTTCTCCCTTCTCTGTGA


invisible?    
Gene introns: 0  

>33277 196 729     Xq11.2    chrX:63390669-63390864 BLAT!
GTGGGACATAGATGTCACAAAGTAAAAACCATGGAATTCCCAGAAGGCAAGGGTAGAAAG
AAAGGGACAGAAAGAATATTTGAAGAAATAATAGCTGAAATCATCCCAATTTTGATGAAA
AACACTAATTTACATATCCAGGATGCTCGATGAACTTTACGTAGGATGAACTCCACAAAC
TTCACACCTAGGCACA


invisible?    
Gene introns: 0  

>4269 182 728     3p13    chr3:72323590-72323771 BLAT!
TATCTTTTACACTGGACAGAAATCATTTTCATGACTACTGGACTGAAATCATTTGCAAGT
TATCAATCTTCCAGAAATTAGCATCACACTTTCCAGAGTCTGGGCCTGAACCGGTAGTAA
AGAGTAAATCACAGAAAAGTATATTCCCCTCCCTTGAGCAGGGTCAGCAAAAGTGCTCGA
TA


invisible?    
Gene introns: 0  

>23136 215 728     9q34.2    chr9:136944490-136944276 BLAT!
AACATACCATGTTCTGTTACGAAGAGACTGAAGCCCTAGTTTATCTGTCATTTCACTGAT
GGCCATAGCATTTGGCAAATCCTGTTTGTTTGCAAAAAGTAGCAGCACTGCATCTCTCAA
TTCATCTACCAGAAGCATTTTCTGCAGCTCATCTGCTACTTCCTGAATTCTTTCACGATC
GTTGCTATCTACCACAAAAATAAGACCCTGGGTAT


invisible?    
Gene introns: 0  

>28426 208 726     3p26.2    chr3:3810149-3810356 BLAT!
CAGTTTTCATAAAGTCCTGTTTTCTTTTAACGACATGTGTATGCATTTGTGGGAGCATAC
AAAAACTCTAAGAATAATAATAAATGAGATTTAGTAGGCATTTACTTTAATCCAACAACT
AGTGTAAGCTCTGTAGGTAATAACACATTTCACCCTAACAAAATAGTGATGGGTTTTATA
TTAAGGCCATTTTAAAAATGAAGAAACT


invisible?    
Gene introns: 0  

>6527 189 723     5q31.3    chr5:143738904-143738716 BLAT!
ACTGAAGAGTTTCTACCACCTCATGCCACTATCTGACAAGTGTTGAGTGGAAATGATTCT
ACAGAAAACATTCTGAAGTGTTTATAATGAACAGAACTTGTAACCTAAACTGTGAGAAAC
ATTCTGGGAGGCTGTTCCATTTATAATCAGTCCTATAGAGACAGGGCACAGTAGGCACCT
GGAGAAATG


invisible?    
Gene introns: KCTD16 (143550436 - 143856944)  

>26683 231 722     16q22.3    chr16:73604295-73604525 BLAT!
TATTTGTGAATAATTAAGACTAAAATGCTTTTCTGATTCCTTCCTAGTTTTTTCTAGTTT
AGACCCTTATATCACACTTGTAAAAATTCCATCTCATCAAATGAATGGCATTAATAAATC
CTAAGCAGGCAGGTTTTCCAAAATGGCGACTTTCATGATATGGAAGGCATTTGATCTTAA
AAACACGAGAAAGAAATTTAGTTGAGTTTTCTCTTTGAAAAGTTTCTTGGG


invisible?    
Gene introns: 0  

>28167 240 722     Xq28    chrX:147279793-147280010 BLAT!
AAACCTGGGAATCAAGATCATTGTCCTCTCTGGTTCTAGGATGGGGGTCCATAGGCCATA
CATCATCAAACCTATGAAATGGCCTCTGGGAGCCCCAGTCTGGTGCTGGTTGGGGGGATT
CACTTCTTGCATCACTCTCCAAGACCCCCCCAAAGATCCTGGGCTGGTGACTATCTGGAT
ACTTAAGCATTGAGTCCCGAAGTGTCTGTCCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>31887 186 722     2p14    chr2:67696375-67696560 BLAT!
CACAATGACTACAAGGATGTTTTCCCTGGAATACATAATCCACACGCTCAGCTTCATGCA
CATCCTGGATACTGCCTGCCTCTGATTGACATAAGGCATTTTAATTTAAAAATGTTTCTC
AAAGTGCCTAAACATATGTTTATGCACTATAGCTATTGAGTAGTATTACATAGAAATGCA
AAATCT


invisible?    
Gene introns: 0  

>5707 167 720     4q26    chr4:115767927-115768093 BLAT!
AGAATTCATATAAGACACTTATTTCCCTCTTTGACATTTGTTATTATGTTTCCCAAAAGC
GGAGTGGTGAAGAGTCTCATCTATATTCCTGCTAAACAATTTGTGTTCCATTTGGGCTCA
CAGATCAGAGAAAATTGCCGTTCTGCTTTTAATAACCTGCATGCAAT


invisible?    
Gene introns: NDST4 (115748926 - 116035032)  

>29840 180 720     13q31.1    chr13:83292504-83292683 BLAT!
TTTAAAAAAAAAAGCTCTATAATTGCATTGTGTTTTATTGTGTAAAATATTCCCCTAAAA
CACAGCAACAAGTTTAATATAAGAGAAGAATCAGTATTTCTCAAATAATTGCCTTTTAAA
TTAAGTTCAAGTAAACTGAAATCTCAGCATTTGCATGTAGAATATCAATAATCCAAAATG


invisible?    
Gene introns: 0  

>4251 170 719     13q33.2    chr13:104964170-104964339 BLAT!
CAGGTTCCAGTTTTACAATGTGCCACATCTCTGCATTCTCTCTTTGGCCTTTACTTCTTA
TCTCAAACAAATTGACTTTTGCTCAATTTTATCTCTTGTTGCATCAAGAAACTACCATCA
CGTGCAACTAATAGTTATCTAACCTCGTATCTTGAAGCTATGGGCTTGGC


invisible?    
Gene introns: 0  

>10523 182 719     2q31.1    chr2:174908566-174908747 BLAT!
CTCAGCCACTAAACGTGTAGGAGCAACCACTGAATGGGCTTAAGCTGTTTATCCACAGGC
TTTTAAGCACCATGAAAAGAAGGCTGACAGAAATAAACACCAATTTATTTTAAAAAGGAA
ATGGTAGGCCGGGCCCCGTGGCTCACACCTGAAATCCCAGCACTTTGGGAGGCTGAGGCA
GG


invisible?    
Gene introns: 0  

>23582 207 719     1p32.2    chr1:56695923-56695717 BLAT!
GAAGGCAGCAGACCAATAGTCAATAAAGAGCATGGGCTTAGGAATCAAACTGTCTTGGGT
TTGAATCCTGACCTTGCCGTCTCCTAGCTGTGTGGAAAGTGACTCATCTCTCTACACCTA
TTTCTCTGTCTTATAAACAAAAAAAACCAATGGGTAGTGGTATTCTACTTATCTGAGAAG
GTGTTGTGAAGATTAAATGAGACAATG


invisible?    
Gene introns: 0  

>24857 184 719     18q23    chr18:73222859-73222676 BLAT!
ATGCTGAGGTTTTATCATGGTGAAGAGTGAGACCTACCTCAGTTCCCCTCCCAGGTCAGC
AGCAAAGCTATTCACCTAACAGCCTTGCTCCTGTCCTGGTGTTTTAGCTATTCAGATCAG
ATAGGCACCTCTTTTCATCTATAGGAATGTTGATGCTCCAAGTAGGGAGGAATTGTGACT
CTGC


invisible?    
Gene introns: 0  

>8761 128 718     15q14    chr15:35606832-35606959 BLAT!
GCTGATCTTCTAACAACTACACGAGAAGTTGCCAAAGAACTCAGTGTCAACCATTCTATG
GTCATTTGGTATTTGAAGCAAATTGGAAAGGTGAAAAAGCTAGATAAGTGGGTGCCTTAA
GAGCTTAG


invisible?    
Gene introns: 0  

>16341 146 716     Xp22.31    chrX:6443900-6443755 BLAT!
TTGGCCTCCCAAAGTGCTGGAATTACAGGTGTGAGCCACTTCGCCTGTCCCTGAACTGGG
AGTTTTTATACCCATTTGCACTGAAGGATTGAGAAGAAAATTTGAGCATTCCTATACACA
AATCAACCAAATGAAATGTGTCAGAT


invisible?    
Gene introns: 0  

Shown 1051-1080 from 3142 sequences on 36 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs