Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1081-1110 from 3142 sequences on 37 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>3244 220 715     18q12.3    chr18:40806418-40806637 BLAT!
AGAAAAAACATTTGAAAATATCTAGCATGTATTTATGATTGAAACTCTCAGCAAAATCAG
CATACAAGGGACATATCTTAATGCAATAAAAGCCATCTATGACAAACCCACGGCCAACAT
AATACTGAATGGGGAAAAGTTGAAAGCATTCCCTCTGAGAACTGGAACAGACAAGGATGC
CCACTCTCACCACTCCTCTTCAACACAGTGCTGGAAGTCC


invisible?    
Gene introns: 0  

>4138 156 714     4q13.2    chr4:69365312-69365467 BLAT!
TTTTTTTTGAAATGACAAGATAATTAGACCAACAAAATGTGCTAGTTAAAAAAATTTCTG
ATTCTACAAAAAGTTTTACTGGGATAATTCCGAAACATATTTATCAAAGTGGTCTGTCAA
TGTGAGGGTTCATTCTAACTTTTGACTTCAATTTTA


invisible?    
Gene introns: 0  

>5102 190 714     11q13.4    chr11:72958791-72958602 BLAT!
GAAATACAGTTTGTATAGGAAAGACAGATTCTTTTCCTTTTAACCTGCCTTTCAGAATAA
TACATTGATAAGCTACCAACCTACAGAACAGACCTACACGTTTGCTTGTTTGTTTGCTCT
TAGTATCATTATAAACTCATAGATTGAAACACAAGTTTCAGATTTGTATGTTTCAATCCA
TCGTAGGCAT


invisible?    
Gene introns: 0  

>6138 162 714     1p35.1    chr1:33965434-33965273 BLAT!
GCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACACAAGACCCCCATCTCCCCCCCAA
AAAAAATGGGGTAAGGGAATATTTTGAATGATTAATTTTGACTTTAGATATTGACTTCAT
TCAGAAAGAGACCTCTCAGGCAGCTGGGTAACTCCAGCCCAA


invisible?    
Gene introns: 0  

>11913 225 714     13q22.3    chr13:77263797-77263573 BLAT!
TCCACAGTTCCATGATGTAATAGAGATCCAGGTTCTTTCCATCTGTGATCTCCAATTCTT
AGTGTCAGCTTCATGCATAGGTAGTAACATGGTCATAGCAGTTTCTACATATGACAAAAC
CCAGAAGAACAAGGGATGCTATTTGTGGACTGAATGTTTGTGTCTCCCCAGAATTCATGT
TAAAACCCTATTCCCCAGTGTGATAGCATTAGGAGTTGGGCCTTT


invisible?    
Gene introns: 0  

>23523 156 713     7p21.3    chr7:12061788-12061943 BLAT!
GCAAATCAAAACCACAATGAGATACCATCTCATACCAGTTAGAATGGCTATCATAAAAAT
TCAAAAATAAGAGATGCTGGCAACGTTGTGGAGAAAAGGAAACACTTATTCACTGGTGAG
TAGGAATGTGAATTAGTTCAGCCATTGTGGAAAGCA


invisible?    
Gene introns: 0  

>29695 153 713     10q26.3    chr10:131597514-131597362 BLAT!
TTTATGCTTCCTGCCCCCATTACTACTTCTTTCAAAATGTTTACATGCTTTGAAATGCAC
AAATCTTAATTGTATATGTTTGACAAATGATACATTCATTTAACCTATATACCCATCGAG
CATCAATTTTCCATCACCCCAGGAAGTTCCTTC


invisible?    
Gene introns: 0  

>2664 192 712     20p12.3    chr20:6877854-6877691 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGAATCCCAGCACTTTGGGAGGCCGAGGCGGGCA
GATCATGAGGCCAGGAGATTGAGACCATCCTGGTTAACATGGTGAAACCCTGTCTCTACT
AAAATACAAAAAATTAGCCAGGTGTGGCAGCGTGTGCCTGTAGTCCCAGCTACTCGGGAG
GCTGAGGCAGGA


invisible?    
Gene introns: 0  

>3828 213 711     11q22.3    chr11:107608972-107609184 BLAT!
AAGCCTTCCTGCGTGTCTCAATGAAGTCATCGTTAAAGCGTTCCACCATTCCTTTTACTA
TAAACTTTTCTGGCAATGGTGGAATAATCAGAGTGGGGTGTGCTTCTTCCAGTTTTCCCT
TCAACCAAAGGAAATCTTGATATCGTCTCCTAACTTCAAATTCACTGGAGTCAAATTCCC
CACGAGATGTCTTAGTAATAATCCTATACGTAA


invisible?    
Gene introns: 0  

>16915 195 711     18q12.2    chr18:35908123-35908317 BLAT!
AAAGGCCCTTAGATGGGGAAAAGGGAAGGAGCATCAGAGTGATATGATGTGAGAAAGACT
CCACTGAACATTACTGCCTTTGAAGTTGGAAGTGGGCTGGGAGCCAAGAAATGAGGACTA
TGGCCCAAACACTTTCCCCTGAAAGTCAGGTGACACCCCAAGGACTAAGCAAAAGAGGGG
GGAAATCCCTGAACT


invisible?    
Gene introns: 0  

>18676 213 711     2q33.3    chr2:206434209-206434421 BLAT!
TTTGAACATCCATGTCATTTTAAGTAGTAATGTGATTTTGTAATATAGTTTCAAGCAATA
TCAACTGACTGTGATATTGTTATAACTAAAAAACACATGGTGGTCTAGACACCCATGCTG
AATGGCTTTAGACAAATATTGTGGAAGATGTCTGTGTAGTTCATTGGCACATGTCAACCA
GAATCAATTTACATCTTGCTCTCACTGATATTA


invisible?    
Gene introns: PARD3B (205410515 - 206480537)  

>21719 184 711     2q31.3    chr2:181784197-181784380 BLAT!
ACTCTAGCCAAACACTATGTAAAATACTGCATGCCTACCCCTAGAAGCAAAGGCAGAGGG
GAGAGTCCAGTCTTTGGACTCTTGCCAGGCTGCCAGGAGGTGCTGCAAGCCCTACCTACC
TCCAGAGTGGTGTCAGAGAAGGCAGAGTGGGAAGCTGAGACCATCATCCCTATCAGGTGG
TAAA


invisible?    
Gene introns: 0  

>31999 218 711     1p13.2    chr1:113280574-113280357 BLAT!
AAGAAGCTATGCTTAGTGGAATACTATAACAATGAAAAAGATATTCTGTAAGTTGGTGTT
TTTGTCAGCAGCATGTGGACTGGGAAAAGAAGTCCATATCCAAAGTGAGTGTCTACTAGG
AGAAGTGTTGCCTCTCTTGTGATGAAAGTGTTCCAATGTAATCAACCTGCCACCAAGTGG
TGGCTATTCAGTCTGGGGAATACTACCTTCTTCAGGTT


invisible?    
Gene introns: 0  

>3879 226 710     2q22.3    chr2:146288333-146288108 BLAT!
GTCTTCATAAATATATTTGATGAAACTCACTGATCAGGGACCAGAGGATCTGAGTCATCA
GGTGCTGTTCCAACCTCACCATGCATTTCTGCTAGAACAGCTAGAGCTTAACATGCCACC
AGCCTTAGTGCCATTCCTTGACCTCTCCTGAGTAGACTGCCAAAAACAAGGTATGATGCC
AAAGTGAATGCCGAAGATCCAATACAGATGCTCTGCAAACTCTAGG


invisible?    
Gene introns: 0  

>17980 206 710     12q21.2    chr12:78139228-78139023 BLAT!
TTTATCTGTGTTCATTGCTTACCCCCAGTCTTCCCCTAGGCAATCTGTCCTATCAATTGG
TCTTTGCTCCTTCATCATTGTCTCTTTCAGTCACCAAACTGACTCAAATATTCCCAGTTT
TTACGAGAACCAATGAATGCCACCTGGCTAAGTGGTCCAAACTGCTATATAAGATGACAA
AAGAAAACCTCAGTTGCATGCAGAAA


invisible?    
Gene introns: 0  

>31255 171 709     4q28.3    chr4:139422852-139422682 BLAT!
TGTGTGTGTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTCTGGGGGTCAGGTGGATGAAA
CTGTGCTGAAATTTGCAGTTCGTATAGGCCAAAGTTGAGGCCTAATTGAGAAGTGGGCTC
AGAGAAGCCTGAATAAAGTTTGGTCATGAAGAGGGTCTTTGTCAATGGTGA


invisible?    
Gene introns: 0  

>1244 206 708     9p22.3    chr9:15055874-15056025 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGAAGAAGAAGGAGATGATCAAGAAGGTGAAAA
GAAGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAGAAGGAATATGCTGAAAGGCCA
ACATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCA
GCAGAATAAAGATGAAGGAAAGAAGC


invisible?    
Gene introns: 0  

>27918 181 708     3p13    chr3:70183160-70182980 BLAT!
GGCCTCCCAAAGTGCTGGGATTACAGGCGTAAGCCACCGCACCTGGCCCATTTTGTTTAA
TTTTACAACCACCTAGCAAGGTAGAAAATATTATCTTCACTTTACAGATGAGGAAACTCA
CATCAGTCTGAACCCAAAGCCTGGATTCTTACCTGCTATACCTCAGAAAATTAATTAACA
T


invisible?    
Gene introns: 0  

>21662 232 707     1p34.3    chr1:34971834-34972065 BLAT!
GGGGAGGTAGTCAGGGCTTGGAAAGGGAAGGCAGGGAACCAGGAGCTCTAAACATTGTTG
ACTCTACCAAATGTAATTGAGATGAAGTTCTATGTTTTTCCTGAGCCCCAAGCCTTCCGC
CAGATACCTAGTGCTGCCATAGGTTGATGAGGGAGGCAAAAAAAGGCCAGGGGTCATCAA
AATTGTGGTCATTATTAAAGGCTCTGAACCTCACTGTGATCTGATGAGTTCA


invisible?    
Gene introns: 0  

>32308 194 707     12q12    chr12:41044212-41044019 BLAT!
AACTTCCCTAATTACTCCTGCAAATAACATCACTATCATAGAACCAAAGATGGGCCTTTT
GAGATATCTTTTCAGGAATTTTTGCATGTCTGAAACTCATGGCTCTACCTGAACCTGCCA
GCCCTACTACTGTGGCCCCACCCAGAAGCTATTCCGCCCACAGGAGGACAGCTTTGACTC
CCTGTGATTTCATC


invisible?    
Gene introns: 0  

>2194 164 706     3p12.3    chr3:74217344-74217181 BLAT!
CCTGGGTGGATCTTCTAATTTTGGCTTGGCTCACTCAGGCATGTGGAGTTGGCAGGGGGT
CAGCTGCATTAGACTGGGCTTGGATGGGAACACTCAGCATTGCTCCACATGTCACTCATC
TTTCTCCTTAGGGCAGTGGGCCAGCACAGGAACATCCTTCTCTT


invisible?    
Gene introns: 0  

>11836 189 706     18q12.3    chr18:39383155-39383343 BLAT!
ATCCTGACTCTACAACTTATGAGCTGTAGGAACTTGAACAATTTATTCAATCCTTTCTAA
ACCTCACATTTTCCAACTATAAAATGGGGAATGAACTACTTCATATTTTTAGGGTGGCTA
AAAGGATAAAATAAGATAAAGTTTGTAAAGCTGCAGGCACAATGCCTAAAACGTATCATG
TTTTCAATG


invisible?    
Gene introns: 0  

>18398 191 706     1p32.2    chr1:56696288-56696478 BLAT!
TTTAATCATTTGGATCTCTTTTCATTCTGAACACTTAGAGTATAAAGAATTTAAGTCTCA
GCTTCTTTCCACAGAGACATGTTGGTCATTGGTGCATATAGCCAAAGTGGTTCCAGTTCA
GTAAACAGTCTTTCATGACAAATCCATGGTTGGAGTTGGTGGAAAATTTGCCTGCTTATC
AGGAGGCTACA


invisible?    
Gene introns: 0  

>23807 170 706     8p21.2    chr8:26238152-26237984 BLAT!
AGAAACAAAAAAAGAAGAAAAAACCAGAGGTGTTTAACTTTTCAGCCATTCACTTGATTC
ATGATCCCCAAGATTTTGCGGAAAAACTACTAAAGCAGCTTGAGTGCTGTAAGGAGAGGT
TTGAAGTGAAGATGATGCTCATGAACCTTATCTCCAGATTGGTGGGAATT


invisible?    
Gene introns: 0  

>28962 185 706     2p11.1    chr2:92250057-92249874 BLAT!
TTTGCCTGTCAACTGGTGGAGAGTTTTCCCCAGGAGACATTTGTCAATGTCTAGGGTTAT
TGTGGGGATGTCAAGACTGGTGGAGGTGTGAAATGTAGAGGTCAAACGAAACACCTAGCA
TTGCTAGGGCAGCCTCCCACAACAAAGAATCCTCTGGTCCTAAAGGTAAGTAGCACCAAG
GCTGG


invisible?    
Gene introns: 0  

>3262 252 705     Xp11.23    chrX:48306223-48306008 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGGGTGAAGCAGGCGTTGTTGTTCCGGATCCAG
GTTACCTAATGGGAGTGCGAGAGCTCTGCACCAGGCACCAGGTTCTCTTTATTGCTGATG
AAATACAGACAGGATTGGCCAGAACTGGTAGATGGCTGGCTGTTGATTATGAAAATGTCA
GACCTGATATAGTCCTCCTTGGAAAGGCCCTTTCTGGGGGCTTATACCCTGTGTCTGCAG
TGCTGTGTGATG


invisible?    
Gene introns: 0  

>29296 190 705     Xp21.2    chrX:29573560-29573371 BLAT!
TTTGGGCTTAAGGAAGGCAATTGTCTGCCTTGAAATGGATGTATCAGTGAGGCATCAGGA
GACTACAAGTTCAAAGTTCTTCAAACTCACTGTCTGTAAGTATTTTAAAATGGTTGCCTC
ACGGCCTTTTTCCTTAAGTTAGAGATACCCAAATATCTCTGTAGGTCAAACAGATCCTGT
GGTGAAAATT


invisible?    
Gene introns: IL1RAPL1 (28605680 - 29974017)  

>30294 163 705     6p12.3    chr6:48162381-48162219 BLAT!
GGGACCACCTGATTTGTTCCCCGCTGGAAGTCATATGTCCTTTCTTCAGTGTTTGAGAAT
ATGACAAGCCCCAGTGAATAGAAACAAAGAGACAGAGTCCTGAGTAAACACACATATTAA
TGTCAGAAAGATTCGGAAGCATCAATTCAGGATGTAGAAGGAT


invisible?    
Gene introns: 0  

>320 170 704     2q37.1    chr2:235303954-235303785 BLAT!
AAAGAAGTTAGCACAAAGAGCATTCCCTCTACCCCAAAGGCTGGGCTCGGGGGCTCACAC
CTATAATCCCAGCACTTTGGGAGGCTGAGGCAGATGGATCACATGAGGTCAGGAGTTCGA
GACCAGCTGACCAACAGGGTGAAACCCAGGTCTCTACTAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>5743 163 704     11q24.3    chr11:129355051-129355213 BLAT!
TTACAGGCGTGAGCCACCACACCCGGCCTTGATAATAGACATTTTAACAGGTTTCTTATT
GTGGTTTAATTTGCCTTTCCCTGATGATTAGTGATTTTTTCATATGCCTGTTGGCCATTT
GTATGTCTTCCTTAGAAAAATGTCTTTTCAATTCCTTTGCCCA


invisible?    
Gene introns: 0  

Shown 1081-1110 from 3142 sequences on 37 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs