Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1111-1140 from 3142 sequences on 38 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>7531 196 704     8q21.2    chr8:86215960-86215765 BLAT!
CATTAATCCAATCCCTACTGAATATAGAGCCAGGCCTAAAAGCCAACTTTTCTGTGCTAA
AGGGTAAACATATGACTTTTAACAGTTAAAATCCTAGTGTCTTCTTGAACACATATTTAA
TAAAGACAGACATATTCTGACCTTGTTTGCTCCAACCTTAATGTTGGCATCCGTGTGACA
CCATAGACTGAATGTC


invisible?    
Gene introns: 0  

>12391 219 704     8q21.12    chr8:79287568-79287350 BLAT!
AAACAAATATACTTAATGTAATATGCTTAATCTGTTTGTCCTAATTAACATTTATTCCTT
GCAAGAGGTTGATTTCTGCTTTGACAGAGAGTAATGTAACTCTTGTGTCCTCCAAATAAT
AAAGCCAGGATTAAAATATCTCAACTTTTCATCCTTCTGAAGAAACACATAAAATTTAAA
GTTCTTTCTAATTGCTTCTGTTTAGAAATCCTGAAGACC


invisible?    
Gene introns: 0  

>15214 195 704     21q21.3    chr21:27750910-27750716 BLAT!
GGCAACCCGAAGAATATTTCCAGATCCCCTGGCCTACTGACTGGCAGACAACCAAAAGAT
ACTTATGATAAGTTAGTTAGAAAGCAGAATGAATGCCACGGATGAAACAGAAATAATACA
AAGTCTCAGGACTTACTGATTTTTGTGTATTATGAGTAAATCAGGTCAATCTTAGAGTAT
GCTTCACTCTAGCAA


invisible?    
Gene introns: 0  

>21346 141 704     10q25.2    chr10:112364621-112364761 BLAT!
ACTAAGCTCAAGATTTTATTCAGATTTGACTAGTTTTTCCACTAAGGCCCTTTTTCTTTT
CTAGGATCCCACAGAGGATACATTACATTTACTTACATCTCCTCTAGTCTGTGACAATTT
CTCTGTCATTGTTTATCATAT


invisible?    
Gene introns: 0  

>16059 138 703     5q21.3    chr5:104964906-104965043 BLAT!
TAAAAGTAGTGAGTGGAACTTACTAAATAAAAATGAAAAATTCTTAACTTTACATTGTAA
TATTCGGTAGACACCACCTTAGTCAAGTAATCCAAGTTAATATCACCAGTAATATGTTCA
ACAAACATCATTTACCTC


invisible?    
Gene introns: 0  

>28111 131 703     3q11.2    chr3:97808321-97808451 BLAT!
TTAAAGAAAAATTTTAGCTGAATAAAATTTTAAAAAGTTTAATTGAGCAGAGAACAATTT
GCCAATTGGGCAGTTTCCCAGCCAGAGTAGGCTCAGAGACTCCACGGCAGCTACATGGTG
GAAGATTTGTG


invisible?    
Gene introns: 0  

>23551 146 701     1q25.3    chr1:184333112-184332967 BLAT!
GTGTCACCTGTGCTAAGGCCCTGGGCTCAGAGAGCTTCCATCCGAGCTGGAAGCAACACT
GCAGAGAAGCTAAATAGCCCACCCCAGCCTCTGCCGGGGACCCAGGAGGAAGCAGTAACG
GCGAGGTGTGCAGCCACGGGGGCTGG


invisible?    
Gene introns: 0  

>27547 132 701     13q12.3    chr13:31589464-31589595 BLAT!
AAGAGAGGAAGACAGCTGCTGGATCTGGAAACTTTCAAATGCATAATGAAACAGAGTATG
AGGTCACAGAATAAAGTAAATGGGTTTTATAAACATTGGATCATTGAAACCACAGTTAAA
ACTTTAACCATA


invisible?    
Gene introns: 0  

>28560 203 700     9q13    chr9:68274066-68274268 BLAT!
TTAAGTTTAGCAGTAAAGACCTGTAAGATTTCTTCTGTTAGGATCATCTAGCCATTCCAA
ACATTTCTCTTAGATTTGATTCTTTCAAGACAAATCAACCCAATAAAAATCTCATAAATA
AAGGTGAGCTAGCTACCACATTTGGTGTTCTCATCTGACCAAACCAAATTTTATGTATAC
ATTCAATTCTCAATCCAACCCAG


invisible?    
Gene introns: 0  

>25740 173 698     8q13.3    chr8:72037655-72037827 BLAT!
TCAATACTTGTAATATATGGTAGATATTTTATGTAGATAATCAGAGCAGTCCAATGAACT
ATTTTTTATTATCCCTATTTTTCACATGGGGGAAACTGAGACTTAGAGAAATTAAGTAAT
TTGCTCAAGGTCCTTTCCTACAGCTAGAACGTAATAGAGCTAGGATTGTAATC


invisible?    
Gene introns: 0  

>30701 143 698     11q21    chr11:96684929-96684796 BLAT!
TTTATTAAATAGGGAATCCTTTCCCCATTGCTTGTTTTTGTCAAGTTTGTCAAAGATCAG
ATGTGTTAGATGTGTGGTGTTACTTCTGAGGCCTCTATTCTGTTCCATTGGTCTATATAT
TGGTTTTGGTACCATATTGGAAT


invisible?    
Gene introns: 0  

>3632 171 697     2q31.3    chr2:181660610-181660440 BLAT!
CACTAAAAGTCTGTAATATATTGAAATATATGTGCCTGAAGAGTTACTGTATTCAAGTGT
ATTATTTAATAAAAATCTATTATTGATTTCCTGATTAAGATTAGATATTTAGTCATTTAC
ATTTTTTTCTATGTATACAGTTTCGTTTTTGAGGAGTTAGTTTGGAAAAGA


invisible?    
Gene introns: 0  

>5765 200 697     12q21.31    chr12:80943997-80943798 BLAT!
ACTAAAGCTTAACGACCCGGATATTTTATTCAAATAACATGAAAGATAAAGGCTGGTATA
AAGGGGAGAAAATAGATGAAAATGAGTCTGATACTGCAACCATATAGTTCAGGAAAACAT
CTAGAATTCCATAAAAACAAGTAAGACTAAAAAGAGATATACATGAAAGGTTTACATGTT
TATTTCTTCTTTTAAATCAC


invisible?    
Gene introns: PTPRQ (80838125 - 81073968)  

>10714 210 697     12q24.32    chr12:129266505-129266714 BLAT!
GAATCATGCTCGTGGAGGGAGGATGAGACCAATGGATAGCTTCCCCCGCCTACCCTGTCT
TGTGCCCAAGCAGACAGCTCTGAGATGCATTTGAAAAGGCTCCTCCAAAGGACCCAGGGA
GTCCGGCCCCAGGCACCCAGGGTGGCTACCAGCTCCGGAACTTCTCTTTCTCCTACTCTC
CTTTCTCCCCGTTTTCACTCCCTGTTCCTC


invisible?    
Gene introns: 0  

>17703 153 697     2q34    chr2:211548909-211548789 BLAT!
ACCCTTTTACCATCATTGGACAAGTAGCATCCGTACCTACAGGGCAAGGCTGAGGCTGAA
GGCTTAACACAAACAGTGGTTTGAGATCCCTGCAGCCAAGAGAGGAGATAAGAACTTGGA
ACTAAAAGAAAGGACCAAACACATCTCCCTACA


invisible?    
Gene introns: 0  

>27550 164 697     11p15.4    chr11:6708964-6709127 BLAT!
TGAGATGACTAGTGTCTGTTTTGTTATGTATATTTTGCTTTTACAGGGATGGAAAATGTT
AGTTTGTTTCCCCATGCAGCCTCTTGGGCAGCATCTTGCAAAATTGAGAATCTTTTGCTT
ATGGTTCCATAAGAGAGAAAAGGGTGATTTTCTTTTGTAAAGTG


invisible?    
Gene introns: 0  

>4302 196 696     10q26.11    chr10:120053863-120054058 BLAT!
CATATATAAACTTATTTTCTAATAAAGTGTGATTAGAAAGTAAGGTTGGCTTATCTATGT
AAAAAATTAATGAGTGCTACTGTCACACACAACGTGAGTATATCTCACAAGCATAAGATG
AACAAAAGAAGCTTGACACAAAAGGATCTCAGATTTCAAGATTTCATTGATATGAAGCAT
AAGAACAGGCAAAACC


invisible?    
Gene introns: 0  

>12037 172 695     4q31.1    chr4:141078398-141078227 BLAT!
TCTCCAGAACTTGGATTTCCCTATGACTTTCAAGGAGTTCTTTAGGAAGGTGACCAACAA
AGCTGGAAACCTTGCAGGACCATATCATGGGATCTGGAAGTAGCCAGCATAAAGGTCTCT
GTTTCTTCTAAGGTCACTGGAGTAGATCAACATCTCTAATTCAGGGTGACTG


invisible?    
Gene introns: 0  

>31804 198 695     10q24.1    chr10:98750359-98750162 BLAT!
GCCCTGAGAGCTCTGAGTTTCTGCCTGAGTCTAATTATCTATAAAGGAAAGAGACTGGAT
CCTCAAGTCTTCCAATCCATCCATTGTAGAATACAGGACTCTGTTCTGATGTTTCAAAGG
ATGAATTATATTGAAGGCTGCCTCAAAAGACTTCCCAGTCTGGGCAACACAGTGAGACCT
CATTTCTGCTAAAACTGG


invisible?    
Gene introns: 0  

>22544 192 694     9p21.1    chr9:30733569-30733378 BLAT!
ATGTCTGTGATAGCCAAGAAGGGTATTGGTATCCACTTCTGTAGCTGCGGGATAGAGTCA
ATTCCACTCAAAACACTTGAGTCACAAATGATATTAGATTATAATTTTAGCTACATGTGG
TCAATAGAGGTCAGCATTAATACAGAACGCTATGCCTGTATCAATGAATGTAGGAAATTA
GAAGAAAGGAGT


invisible?    
Gene introns: 0  

>3157 207 692     11q22.3    chr11:107607693-107607514 BLAT!
GCTGTTGCGTCCTCAATGAGAGGAGTTAAAAACCGCCCAGAGGAGTTCATGGAAATGAAT
AACTTTATTGAACTATTTAGCCAGAAAATAAATTTGATAGATAAAATATCTCAGAGAATT
TATAAGGAAGAAAGGGAATATTTTGATGAAATGAAAGAATATGGCCCAATTCATATTCTG
TGGTCAGCGTCAGAAGAGGATCTGGTT


invisible?    
Gene introns: 0  

>6279 155 691     1q43    chr1:237248732-237248578 BLAT!
TTTTATCTGATGGGGTAGATTTTATTTTACGCAACAGGGAAGGGACTCCAAAAGACAAGA
GTAACTTTTCCAATAGTAGAACCAATAACTGAAACTCAGATATTTTTGACTCCAAAGACT
TGACTCCTTTTGATAAGTCACGGTTCCATCCCAGT


invisible?    
Gene introns: RYR2 (237205701 - 237997288)  

>2236 150 690     Xq13.3    chrX:74960042-74960168 BLAT!
AGCGTGGTCGCGGCCGAGGTACTTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGCCC
AGGCTGGCGTGCAATGGCGCAATCTCGGCTCACCACAACCTGCGCCTCCGAGGTTCAAGC
AATTCTCCTGCCTCAGCCTCCTGAGTAGCT


invisible?    
Gene introns: 0  

>4654 192 689     16q23.3    chr16:81755685-81755876 BLAT!
ATAAAACAGGGGCCAGTCACGGTAGCTAATACCTGTAATCCCAGCACTTTGGGAGGCCGG
GGCAGGTGGATCACCTGAGGTCAGGAGTTGGAGACCAGCCTGACCAACACAGAGAAACCT
CGTCTCTACTAAAAATACAAAATTAGCCAGGTATGGTGGTGCATGCCTGTAATCCCAGCT
ACTTGGGAGGCT


invisible?    
Gene introns: 0  

>13780 188 689     11q22.3    chr11:102916604-102916417 BLAT!
AGAAAAACATTAAATTTAATATTAATAGTAAAGACATTACACAATGAATAAGGGCAAAAT
TTAAATTTGCTTTAAATATTTCTTTAGGGGAGAGGACACCCACTTCTACTCAAAGAAGAG
AAACATTTTTACAGTTCAGAGGCCTTTTACTTTTCTACACCTATTATGCCATGAATCCAT
AGGGAAGG


invisible?    
Gene introns: 0  

>32611 209 689     9p22.3    chr9:15055874-15056025 BLAT!
GCGGCCGCCCGGGCAGGTACGCGGGGGAAGAAGAAGGAGATGATCAAGAAGGTGAAAAGA
AGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAGAAGGAATATGCTGAAAGGCCAAC
ATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCAGC
AGAATAAAGATGAAGGAAAGAAGCCAGAA


invisible?    
Gene introns: 0  

>10655 153 688     4q31.1    chr4:141079266-141079418 BLAT!
GTAGTTCCTTCTCACACGATTGTGAGTGTGAAAGAGTGTGATGAGAAATGAGATGGAGGC
TGGGGAGACAAGCAGGACCTGGATTGTTCAAGGCCATCCAGTTTAGACTATATCCTTGGG
ACAATGGCTGCCATTAAAAGGACTTAAGCTGAT


invisible?    
Gene introns: 0  

>24613 213 688     4p15.1    chr4:28628123-28628335 BLAT!
CACAGGGACTCTGGACTTCATAAGTAACTTTCTTTGGCCAGTGGGAGAGCAGCAAGAGTG
ATATAAGCATACATACGAAAAGAGATGTCTCTTTACTGTTTGCTTTACCTGGTAAACAAG
ATGTGGCTATTCTGCTGGGAAGTAAGAAGGCAGAAGCAGTAATATTCAGCACCCTCCTGC
AGCTAACTCTCAGCTAGTCCCAGTTTACCTGGC


invisible?    
Gene introns: 0  

>17206 143 687     7q21.11    chr7:84335120-84335262 BLAT!
GAGTTTGAGACCAGCCTGGCCAATATGGTGAAACCCTGTTTCTATAAAAAACAAATTTAA
AAATTACCCAAGCATGATGATTCACACCTGTAATCCCAGCTACCCAGGAGACTGAGGTGG
CAGGATCACTTGAGCCCAGGAGT


invisible?    
Gene introns: 0  

>547 144 686     1p35.1    chr1:33965434-33965296 BLAT!
GTATTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACACAAGACCCCCATCTCCCC
CCCAAAAAAAATGGGGTAAGGGAATATTTTGAATGATTAATTTTGACTTTAGATATTGAC
TTCATTCAGAAAGAGACCTCTCAG


invisible?    
Gene introns: 0  

Shown 1111-1140 from 3142 sequences on 38 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs