Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1141-1170 from 3142 sequences on 39 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>3838 193 686     9p21.3    chr9:21395521-21395329 BLAT!
TAGTCATGGTTTTCATTGGAGAATTTTATTAACATTTTCCACTTGGTTCAAAATGTCATC
CCACATAGATAAGTTGCATAAAAATGTGTAATCTCTTTGCATTAAGATGCTTTCCATTTC
AGCATAATGCAGGTTTGCATTTGGTATCATTTACTGCTTAATACATATCTTAAGTGCCAA
TACATCGATTTTT


invisible?    
Gene introns: 0  

>23935 159 686     16p13.2    chr16:8509436-8509278 BLAT!
AATTAACCTCATCCAATTTCTGTGAAAATTCAATGAATGAATCAATAGAAAACTTCCAGC
ATAGGGGAAACCATTTATTAGATGTCAGCTTATTATAATTGTGAGTAGAGGCTTAAAATG
ATATGCTGTGCTTGGGAAGGGCAGAAAGTGATGTATTTG


invisible?    
Gene introns: 0  

>18146 179 685     22q12.3    chr22:35898633-35898802 BLAT!
ACCAGGACGTCAAGGTAATACTTCTCTAAACCATATTGACGAAGATTGGCCCTAATGTTT
TCATCTGGTCCTCTCCACTTCTGGTTTTTCCTAGTAGCCTTTCCCAAGCCATGAACTGTG
TTGTAGTCTATGTCTGTCCCATACACATATGCACCAAAATGAGCACATGCTATCAGCAG


invisible?    
Gene introns: 0  

>14671 187 684     12q21.2    chr12:78118695-78118509 BLAT!
AGTGTAAATTCACTTTTGAAAGATTTGACATCTGAATTAGCACAGAACATAAACTTTCTT
TATGAAGTTGACTTTAACAGAAATTGCAAAGCTTAATTTATACAGTATCTTCAATTACAT
GAATATTATGTTCTCAAATATTTCATATAATGCTATTTCTAAAGACTTCTCTATTTCCTG
CTTTTTT


invisible?    
Gene introns: 0  

>115 123 683     20p11.21    chr20:22763500-22763622 BLAT!
AAGGGCACACCATGACACCTGGCTAATTTTTGTATTTTTAGTAGAGATGGAGTTTTGCCA
GGTTGGTCAGGCTGGACTTGAACTCCTGGCCTCAGGTGATCCACCCGCCTTGGCCTCTCA
AAG


invisible?    
Gene introns: 0  

>10191 198 683     7q32.1    chr7:128817289-128817092 BLAT!
ATGGTCGTGGCAGTTTTATTTGTAATAGCTCAAAACTGGAAACCAACCAAATGTCCTTTA
ATGGGTGAGTGGTTAAACAAACTGTAGTTTATCCATACCATGGAATAATACTCAGAAATA
GAAAAGAACAAACTATTGATACACGCAACAACTCGGATGGCGCTCAAAGAAATTATGCTG
AGTGAAAAAAGCCAGTCT


invisible?    
Gene introns: 0  

>30425 185 681     1p22.1    chr1:93829031-93828847 BLAT!
TCAATAAAGAGCCAACCCTGCTGATACTTTGATTTAGGCCTAATGAAACTGATTTTTGGA
CTTCTGATCTCCAGGACTATAAAAGAATAAATCTGTGTTGTTTTAAGTCACTAAGTTTGT
GGTAATTTGTTACAGTGGCAACAAGAAACTAAAATATTCACAAAAATGATGAATGAAAAA
AAGTG


invisible?    
Gene introns: 0  

>1221 137 679     2q31.3    chr2:181708083-181708203 BLAT!
AGCGTGGTCGCGGCCGAGGTACATGCCACCATGCCTGGCTAAGTTTTGTATTTTTAGCAG
AGACAGGGTTTCGCCATGTTGGCCGGGCTGGCCTCGAGCTCCTGACCTTAGGTGATCCAC
CCTCCTAGGTCTCTCAA


invisible?    
Gene introns: 0  

>25750 183 679     3p22.1    chr3:42397866-42398048 BLAT!
CTCATTGACAATACACCTAGACACTCAAGAGCTCTGATGGAGATTTACAAGGAGATTAAT
GTTTTTTTCATACCTGCTAACACAACATCCATTCTGAAGCTCATGAAATAGTGAAATGAG
TAATTTTGACTTTCAAATTCTATTATTTCAGAAATACATTTCATAAGGATATAGCTGCCA
TAA


invisible?    
Gene introns: 0  

>27154 206 679     2p21    chr2:47025384-47025179 BLAT!
CACACAGAGCAGGTCACACACAGAGCATCTCTAGTTGAGCCCACTGGCCTCATCACAATG
CCTGTGAGCTGTTCATGGGCCTGTAGAGTTCATGCCCCTCCTCATGTGTCAACACAGGAG
CTAGTCCACGCTGAGGAAAACATTTATTGTATCTTTCCCCAATAGAGTTTCTGTGGAGAG
ATTCCCCACCTATTTTCATAACTTCT


invisible?    
Gene introns: 0  

>16484 167 678     3p21.31    chr3:46103552-46103718 BLAT!
GTGCCCATTACATACAGAAGACGTTGAGTCAGCAGAATTGGGCCCAGGGCACCTCTGGGA
CTTTGGGGCTTTTTCAGTGAGTGGTTAGGGTTCAGGAGAAAATAGATGGTTTCTGAACTC
CTTGGGGAGATGCAGGCCTCCTGGAAGCAGGACCAGTGGATGTGAGT


invisible?    
Gene introns: 0  

>17612 190 677     11p13    chr11:34836325-34836166 BLAT!
GAGCGGCCGCCCGGGCAGGTCCGGGCAGGTACAAAATAACTTTTCTCACACCTTCATGTT
CAGTCTATGTGTGTCTTTATAAGTGAAGAGCATTTCTTGAAGGCAGCATATAATTGGACC
TTGGTCCTCTGTCCTTTTAGCCACTCTATGCCTTTTAGCTGAAGAATTGAGTCAAATTTA
CATTCAGTGT


invisible?    
Gene introns: 0  

>18514 164 677     10q22.1    chr10:71192756-71192919 BLAT!
ATCAAACAGAAAAGCCCCATGGCCTCAGACAGGGCAAAGCCAAGAATGGCATAGGAGAAG
AGCTGCTGCTTGAGAGACGGGTTCCTGGCATAGCCAATGATCAAGCTGCCAAACACGGTT
CCAATGCCAGCCCCTGAACCAGCCACACCAACTGTGGCTGCCCC


invisible?    
Gene introns: 0  

>25887 194 676     5q23.2    chr5:122955901-122956094 BLAT!
CTACTACAATTCACACTCCACTGTGCCTTAAAAGTGCAACACTCAAAGTCCACTTTTTAA
AACTTTTTTTGACATGATGTATATGCACTGGTAATAAAAAATAATAAAATGTCCGTATGA
CAATATGTATGACACTTGAAATGCTGTTGAGTTTTATAGCCATCACTGAGATTTGTAGCA
TGTTGAATAGCAGT


invisible?    
Gene introns: 0  

>26174 177 676     18q21.2    chr18:49860775-49860951 BLAT!
CCATTACAGCATCAACTCAGAGTCCAAAAAATCTCACATTAGCAGCTCAAAGGACCCAAA
TCACATCATCTAAATCAGGTATGGGTAAGACTCTGGCTATGACCCATACTGGGGAAGATT
TCCTCTTTTCTATGGACCTGTGAAGCTAGAAAGCAAGTTATATGATCTCAAAATACA


invisible?    
Gene introns: 0  

>18673 170 674     8q24.12    chr8:122226664-122226495 BLAT!
AAGATCAGACTTGATCATGGAAAACCATGCAATCTGGCCAGTGCACACTCTCCATCCCTG
CTGCCCAGCCTACTCTGTTCCATGTGCACAATGTGCCAGTAGCAGAGTGGTTGACATTAA
CTGGGTCAATCAGTCTACTTGGTTACTTAGTGTCTCTCCTATGGTGGATC


invisible?    
Gene introns: 0  

>4238 209 673     7p14.2    chr7:35251725-35251517 BLAT!
ATTTTTAAAAATTGAAAGAGTGTCAGTTGTGGGAAAATTTCAAGTGGCCTAATATCTGTG
TAATTGGAGGCCCTAAAGGTGGTTGGGAGGTGGGACAAAAAATATACCCAAAGAAATAAT
ATCTAAAAATTTTTCAAATTTAATGACAATTGTAAACACAATCCAAAGAAGCCCAACAAA
CCCAAGCTCAAAAAGCATGAAGAAATAAT


invisible?    
Gene introns: TBX20 (35242041 - 35293711)  

>33166 197 673     5p15.2    chr5:10209278-10209082 BLAT!
TAGACTTTTGAATGTTGAACTAGCCATGTATTGCGAAGATAAATTGCACTTGGATATAAT
GAATAATCTTTCTTATGATTACTTGATTTCATTTTCTAATATTTTGGTGATAAATTTTGT
ATCCTATATTCATAAAGAATAGTGATCTTTAGTTTTCTTTTCTTGCAAAGGTCTTTTTTA
GGTTTTGGTATCAGGGC


invisible?    
Gene introns: 0  

>9210 220 671     2q32.1    chr2:186887266-186887485 BLAT!
TGCTTGTTATGGGAAATCTCTATTGAGACCTACTTCTTCATGATTTAGTCTTAGTAGGTT
ATATGTGTCTAGAAATTTATTTCTTCTGGGTTATTTAATTTTTTAGTGCATAATTGTTCA
TAGTAGTCCACTATATTTTTTTGTATTTCTGTGGTATCAATTATAATGTTTCCTTTTCCA
TTTCTGATTTTGTGCCCACTTTAGTTTAGCTAAAGGTTTT


invisible?    
Gene introns: 0  

>23534 179 671     8p11.1    chr8:43519193-43519371 BLAT!
ATTTGGGAGCCCATTGAGGACTATGGTGAGAAACCAAATATCCACAGATTAAAACGAGTA
AGAAGCTGTCTGCGAATGTGCATTGTGATGTCTGGATTCATCACACAGGGATACAACTTT
CTTAAATGCAGTAGGTTTTATGCACTCTTTTTTTAGAGTCTGCGTAGGGACAGTTGGGA


invisible?    
Gene introns: 0  

>27873 170 671     Xq28    chrX:153820955-153821124 BLAT!
GGGACACTAGGGACCCAGCTGCCGCCACTCAACACATGCTCATCCCAGACTGGAGAGCTC
ATGGGCTAGAGAGAAACATGGAAAGAGTCAGCAGAATAAAGGTGCTACATGTTTGCTGGT
CAATCCTGAGGAAGTCGTTTCCTTACCCTTAGGTTGGCTTTCCATGCCAT


invisible?    
Gene introns: 0  

>29491 181 670     Un_gl0002280    chrUn_gl000228:118442-118612 BLAT!
ATAAAGCAATAGCACCTGGGAGATCAGTGCGGAGATACGTCACAATGTTCCCAGTGGTCA
GAGACCAGGCAAGAGTTAGAACACTTCGGGATCGGTGCAGAGATATATCTCAATCCCCCA
GTGGGCACAGCCTAGACAAGAGTTACATCACCTCGGTTAACAGTGCAGATATATGTCAAA
A


invisible?    
Gene introns: 0  

>20557 227 669     8p12    chr8:33084388-33084614 BLAT!
AGAGTATACCTATATTCACTGGGTGCTAGTTTCTGGAAGGAGCTCTCAGGTGGACTGCTT
GCTACATCTTGGGCTTGCTCTCCTGGGGCTGTATCAGTTGGGTCAGGTCCATGATGGAAT
TCTCTGTGCAGTTTTCCAGAATGTAAGTCAAATACGAATTGCTTGAGTTTTCCAGGAATT
AATACATCTTTGAAGTCTCCAAACACATACATATGCCTAAAGCTGTC


invisible?    
Gene introns: 0  

>1674 167 668     6q24.3    chr6:146692950-146692826 BLAT!
TGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTATTCAGCCATAAAAAAGAATG
AGATCCAGTCATTTGCAACAACATGGATGGAACTTGAGATTATTATGTTAAGTAAAATAA
GCCAGGCACAGAAACACAAGCATCACATATTCCCACTTATCTGCGGG


invisible?    
Gene introns: GRM1 (146348781 - 146758731)  

>12756 208 667     4q25    chr4:109722867-109723074 BLAT!
ACAGGTAAGTTTTGGTTTCATCAATTGTGTGAGTGGTGATACTATTCCCATAGTGATACT
ATGTGGGGCAGAGGAGGAGGAATGTGGCAGAGGGGCGGTGGGCAAGATCCGTTCTGCATG
TGTTGAATTTGAGGTGCCAGTTGCACATCCAGAAGAATGCAGCTGCAATCAAAACTGGAG
TTTGGAGAGAGATAGTGGCATATTGATG


invisible?    
Gene introns: 0  

>15230 181 667     9q31.1    chr9:105459634-105459454 BLAT!
CTGGTTTCTGCCCATCCATATGATTCTCCTTTATCAGTCACTTGGCCACACCCCTGGTGT
TATCGCTTGAATACATTTTCTCATTTTCTAGAGGGTGTGAATTTTCAACTCATTACATTC
TGCTTCCCCTTTGATTATAAATTTCATTTTTATCCTTTTTTTCCTCTCCTCTTACGTTTT
T


invisible?    
Gene introns: 0  

>22589 242 667     3p12.2    chr3:83227325-83227084 BLAT!
TGCCACGAACCTAAAAAATTAAAAAGCAAAACAAACCTAAAGCAATCAGAAAGAAAGTTA
TGAACAGAAATAAATAGAATTGAAAGAGAAAAATGATACAGCATTAATGAAATGTGAAGC
TGGCTTTTAAAAATATTATAATTGATAAACTAGTGAGACTGATAAAGCTGAAAGAAGACG
AAATCACCGGTATCAGGAGAAACACTTTATTACAACAGATTCTGTGGTTATTAAAATGAT
GT


invisible?    
Gene introns: 0  

>33318 191 667     Xp11.22    chrX:52808583-52808773 BLAT!
AACTGGAGGCCAGGTGCGGTGGCTTACGCCTGTAATCCCAATATATTAGGAGGCCAAGGT
GAGAGGATTGCCTGAACCCAGGAGGTGGAGACCAGCCTGGGTAACATAGTGAGACTCTCT
AGACAAAACCTAAAAAAATCAGTGGGGCGTGATGGCGCATGCCTGTAGTCACAGCTACTC
TGGAGGCTGCT


invisible?    
Gene introns: 0  

>24140 172 666     5q22.2    chr5:112034301-112034472 BLAT!
AACAATATAACAATGAAAATAATAAAAATAAAAACCAATATAGTATAACAACAAGTTACA
TAGCATCTATCCTGTATTAGGTATTACAATCATGAAGTGCATAACAATATTTTAGTCAAT
AACAGACCACATATACAACGATGATTTCCTAAAATTATCATTCTATATTTTT


invisible?    
Gene introns: 0  

>12357 202 664     Xq13.3    chrX:74875688-74875487 BLAT!
GTTCACCTTATCACCATATTGCCACATCTGTCTGCTCTTCCACCTCTGCTACCCCTGTGG
ATAGATGAGTGAATGACATGAAGACAGGGTCTGCCAAGCAATCCAATCTCTCTTTCTTAT
TTGCACTCCCACATCCTCACTCCCTGATCAGACCATTCTAATAATCTTCTCTCTAGTCCT
CGGTTCCATCTTCAATAATACT


invisible?    
Gene introns: 0  

Shown 1141-1170 from 3142 sequences on 39 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs