Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1201-1230 from 3142 sequences on 41 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>23783 154 651     1p34.2    chr1:40621461-40621614 BLAT!
TGGACTCATACAACATTTGTCTTTTTATGATGCTTGTTTCACTTAGCATAATCAACATTT
ATCCATGTTGTAGCACGTGTCAGAATTTCCTCCCTCCCCCTGTTTTTTCAGGAATGAATT
TCTTTCCTTTTTAAGGTTGAATAACATTCCATTG


invisible?    
Gene introns: 0  

>18797 167 650     4q32.3    chr4:165607201-165607035 BLAT!
TTGTGGCTCTCTTACTGACAGCTCACACTCATTCAAGTCCAAGTTTCCTCATCTCCCAAG
ACACACTCTCCTGACACCGAATGTAGACTTATATTAGTGAGTCATTGTTGCCTTCTCTTT
GGAAGAGGCACTGGGATTTTCACCTCTTGTTAATATCTGTGCTTCAT


invisible?    
Gene introns: 0  

>19106 251 650     Xq26.3    chrX:135538693-135538902 BLAT!
CTCTCTCTTTTTCTCGAGACAGGGTCTCCCAACGTTATGCAGGTCTCAAACTCTGGCCTC
AAGTGATCCTCCTGCCTTGGCCTCCTAAAGTGCTGGGATTGCAGGTGTGAGCCACTGCAC
CCAGCCAGAAATTCTTTATTATTATGTAATCAAGTGTATCAATCTTTATAAAAAAAGTTT
TCTGGATTTAGTGATGTATCTAGAAAGGTCTTTTTTACTCTGAGGGTAAAAACAACAGAC
ATTTAAACAGA


invisible?    
Gene introns: 0  

>29454 169 650     4q13.3    chr4:74603986-74604154 BLAT!
GAAGAGAATGAGAGGGAGATATAGTGACATGAAAATAAGGAGGAAAACGAGGTGTCTATG
TAAGTTGGGCTCACCATAAATACAAAGGCAACCGTTAGGGAAAAGCAAAGAAGTCTTTGC
ACATCCTCAGAACTCTGAATGTCTTAGTGATGCTGTATGAGTGAGTCTT


invisible?    
Gene introns: 0  

>10489 179 648     19q13.11    chr19:34424896-34425074 BLAT!
TGTGATTTTAGATCTTAAACTCTTGATGATGGCTTTCATTTCTGGGTAAAACTGATGCTT
TCCTAAGAATTCCAATAGCTGCAGCACCACAGAGAGATGTTCAACAGATAAAGAGCTGGT
CAAAATGGGATAAGGCTTAGCTTGCTGGCTTATCTCACTTCATCCCTCGCCAGGTTTCC


invisible?    
Gene introns: 0  

>10885 173 648     Xp22.2    chrX:11668461-11668633 BLAT!
TATTTTTAGATTGGTTTTAGATTCAGTCAATGAACATTTATATAAGCAGCATCTACTATA
TCTTTATATAAATTAGAAATGATAACCTCATAAGGAGAGTAAAATACACAGTAGGATTTT
AAACATTTTCTGTAAAAAAGGCTATTTCTTGATGAGGAAAGGCAAACTAGACA


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>20593 123 647     3p26.1    chr3:4008665-4008787 BLAT!
TATCATACTGAATGGGCAAAAACTGGAAGCATTCCCTTTGAAAACTTTCATAAGACAGGG
ATGCCCTCTCTCAACACTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATCAG
GCA


invisible?    
Gene introns: 0  

>25193 175 647     2q22.3    chr2:147146593-147146767 BLAT!
ATTAGAAAGTAAGACTCCAAGCATAGAATCCTACTTCTGTGCAATTAGATTAAAAAGATA
TGCTTTCCTCCCCTCCAAAGAAAGTGTTAACTCATGAAACTCTCAATCAAGGATTCCTCC
TTTCTAGCATTTATTTCTCATCATCCATCACAACCAAGGTGAGTGTAAACTAAGA


invisible?    
Gene introns: 0  

>29429 132 647     2q21.2    chr2:134832452-134832583 BLAT!
CCACAAACTCACATGACAAGAGTGTGCGCTGAAGGGCAAGTGGGAAAAATAATGTAATCT
ACCACCCAAATATTTTCTATTTTAAGCTAAAGCTATAGTTATTACCATGTTTGGAACGTT
AGAAGACCCCAC


invisible?    
Gene introns: 0  

>4028 180 646     3p12.3    chr3:74216100-74215921 BLAT!
TGGAATGTTGGTGTATGCTAGGCAGACAGTGCCTACCCCCAGTAACCCTGGGCTCTGAGT
CCTTATGAGCGTCCCTGATAGACAGCATTTTAAGTGTGAAGTCACATCTTTCTGCTTGGG
AATTAAACACATCCTGCGTGACTCCATTGGGAGAAGATTCTGGGAAGCTTGTGCCTATTG


invisible?    
Gene introns: 0  

>30592 182 646     18p11.22    chr18:8674280-8674099 BLAT!
GCCCAGGAACTGCCTGTTCAAACTTGGACTGGCACTACCCTGGTTATTGGTCCTTATAGC
CAAGGAAAATCATCTCAAAACAATTATGTAATCCTCATTTTCCCTTTAAAAACATTTGTC
TTTCTTCACCTCCCTGAATCCACACATAGTTTACCCAAGACATGCATATTCTCATCACAA
TG


invisible?    
Gene introns: 0  

>2739 193 645     21q22.2    chr21:42434024-42433832 BLAT!
ATTGCATGCGATGGTGTGTTTCACATTCTGCAAAAGGACAGGGAAAAGGGCTGGGGAAAC
AAGGAGCCATGTTGGATGTGGTGGCCAGGGAAGGCCTCTCAAGAAAGAGGCATTTGAGCA
GAGACACCATAAAGTCAGGGCGTGAACCTTGGGAAGGTCTGAAGAAACTAGGGTCTCCGC
AGTGGACTTGGCA


invisible?    
Gene introns: 0  

>24400 144 643     20p11.21    chr20:22763521-22763664 BLAT!
GCTAATTTTTGTATTTTTAGTAGAGATGGAGTTTTGCCAGGTTGGTCAGGCTGGACTTGA
ACTCCTGGCCTCAGGTGATCCACCCGCCTTGGCCTCTCAAAGTGTTGGGATTATAGGCAT
GACCTACCGCACCCAGCCGTTTAT


invisible?    
Gene introns: 0  

>26736 181 643     Xp22.32    chrX:4495899-4496079 BLAT!
TAAAAGTGTCCCATGGTGGTTTGCTGCACCTATTAACCCGTCACCTAGGTATGAAGCCTG
GCATGCATTAGCTATTTTTCCTGATGCTCTCCCTCCCTTGCCATCCCCCTACAGGCCCTG
GTGTGTGATGCTTCCCTCCCTGTGTCCATGTGCTCTCATCGTTCAGCTTCCACTTAGAAG
T


invisible?    
Gene introns: 0  

>2649 207 641     4q27    chr4:123457581-123457374 BLAT!
CTAGGTAAACTGAGATGAATGAAACAAGGGCTCTGCTCTTGACAAGTTACATTTCTTCTT
TTACATTATTGGGTTAAAATGAATCATGTTCTAGCAATTTGCCTTTTTTTTTACTTACAA
AAATGGCAGTTTCATATAGTTCAACTTAATAGTTACTATATTGTGTTGCACTGGTTTAGC
ATTAGAATGATAAGCAGGCATTCCTGA


invisible?    
Gene introns: 0  

>19823 199 641     1p33    chr1:47924829-47924631 BLAT!
GACACTACAGAGATAATGGCCGTAGATACTCTGTGTAGAGCAGTATTCACGAGTGAGTGA
TTGCTAGTAATGCCCATCCCAAACAGAGTCCCAGGAAGTATACTCTTCCCGCATAATTAT
CTATCAGAAAATTACCCACACGCTCAACTCTGCATTAGGGTAACCAGATAAACACTACAT
ATATTTTTTCATTTCCTTG


invisible?    
Gene introns: 0  

>23508 182 641     13q12.12    chr13:23352651-23352832 BLAT!
TTGCATGTAAGCCACATATACACATTAGAATATTTGCTGTAGAATGAAAGGGCACAATTA
TTTTCCAGAAATTGTATCATGGCCATACTGTCTGCAGACTCTGGTATAATTTCAATCTCT
GCCTCCACTTTCACTTGGCCTTCTCCTTGGGAAGCTTCATGTCTTCTTATAATGACACTT
AC


invisible?    
Gene introns: 0  

>22044 143 640     21q21.3    chr21:29230044-29229902 BLAT!
TAGGAACTGGTAAGGCTTGTCCAGTTGACAAGACACTCTTTGCTAAAATTAACATTCTCT
CTTGCCTCAGAGGTTTCATCACTGCTATTGTTGTTGTCGATATTGCTGTTTATTAAAACT
GTATTTTGTAAATTACCAGTGAG


invisible?    
Gene introns: 0  

>530 119 639     22q13.2    chr22:43172589-43172703 BLAT!
CTCCTCCATCATGTCTGGAGTTACGCTGTTCTTTATGTATTGAGAGAACTGTTTCTTGTA
AGCATCTTCATCTTCTTCCATTAAGTAGCGCATGTAATCTGCAACATTCTGGCCCCCCC


invisible?    
Gene introns: 0  

>1738 171 639     16q22.3    chr16:73604319-73604489 BLAT!
ATGCTTTTCTGATTCCTTCCTAGTTTTTTCTAGTTTAGACCCTTATATCACACTTGTAAA
AATTCCATCTCATCAAATGAATGGCATTAATAAATCCTAAGCAGGCAGGTTTTCCAAAAT
GGCGACTTTCATGATATGGAAGGCATTTGATCTTAAAAACATGAGAAAGAA


invisible?    
Gene introns: 0  

>10273 134 639     12p13.31    chr12:7449842-7449975 BLAT!
GCTGGGTGTTAATCTTAACTTTTAGTAATTCAGGAGAATTTCCAAGACAAAATCCCAATT
CGGCTACTTACCTAGGAATGGGGCCCAGGCTGAAGATTGCCCTCCGCCATTTTAAACGCA
GGAAAAAACCTTAA


invisible?    
Gene introns: 0  

>19014 225 639     4p15.33    chr4:11597133-11596971 BLAT!
ACCTGGAGTAATGGTTATCATTTATTTTTCCTTTTCTTCTTTATCATAATCATATCAACT
GAACCACACTTGCCATTCTGAAACACAGACTTTGTTCTGGAGAACAGGGAGGACATGCAG
AGCTGTTGTTTCAGATTCTTCAAACAGTCATTCAGACAAGATCTTAGTGCCACTTTGCTT
ATAAGTAAGCCGGTAACTGGCGGTGTTCTTCCAGTGAATGGTTTT


invisible?    
Gene introns: 0  

>33299 178 639     3p24.3    chr3:17853375-17853552 BLAT!
AGAAAAGACCCATATCATAGGAATTGAGGAGGTCAAGGAGCTGTGAGGCTGAAGTATTGA
ATAATCCCTCCCCATTGATTTTTTTTGGGCAATTTTTTGATGAGAAGTGGTAGACTGTGA
TAAGGTGAATGAGGGAATGACTAGAGCATAGGTTATCTATAAGCCTCATGAGGGCAGG


invisible?    
Gene introns: 0  

>5719 132 638     1p31.1    chr1:80340304-80340173 BLAT!
GTATTTATTAAGTATGTTCCTATGTAAGACAAAGAAGCATTTAGAGCCAGTTGTGAAATC
TCCTTTCTCTGCTGGAAACGAGAGGAAATTAAGGCAATGAGAAATAGAAGAGGTTATCCA
CTCCAGTGGCAG


invisible?    
Gene introns: 0  

>2386 197 636     1p13.3    chr1:107360382-107360186 BLAT!
GTCATTTTTTTGCTTCCCTCTGGGGCTTTTTTGCAATTTCTCTGCATATTCTTTGACCTT
TGCTTCTTTGACATAGCTAGATCTTTTCAACAGCAAGCTTCTTCCTCCTGTAGAACTAAA
AATATTATCTTCCTTTTAAAGTGGAGGAACAGCTTCACACTTCTTGTGTCCTGGTATATG
AGTTCTGATGGTGATGG


invisible?    
Gene introns: 0  

>17132 202 636     8q24.12    chr8:121855513-121855709 BLAT!
CTCAGTTTGGGATTTACTCTCAGGAAACCATTTCTAATTGATGGTTAACATGGTCACCAG
AATTTCCAGGTTTACCTCACTCTCACAGATAGAGATCACAATCACAGAGAACATAAATTC
CTTTTTCCTGAGAGTTTCAGCAAACGTTGACATTCTCTGACCTGCTGACATCAAGTGTTG
ATCCCTCAGCTGATCCTGTGAC


invisible?    
Gene introns: 0  

>17290 216 636     11q14.1    chr11:85161819-85162034 BLAT!
AAGTTTTCGGTGGAATTGAACTATCTTTCCTTCTTCTCTTTTCTCAGCTTCCATAACTCT
ATATTCTTTTTGTTTCCTCCTACCCATGTAGCTTTTTTCTGCCTCCTTTGCTTGCTCTTC
CTCCATATTTCTAAACATTGAAACCACTCAGAGCTTGTTTCTAATCATCTCCTCAATCTA
CATTCTCATCCTAAGAAATCTTGACCACTTCCATGA


invisible?    
Gene introns: DLG2 (83166055 - 85338314)  

>16897 186 635     6p22.3    chr6:17847358-17847543 BLAT!
ACACACACTCTAAATTCCAACAAGTCTACAGACTTTCTAGTGTGATCCCACAAGCCCCAC
CGGGAGGCATGGCCCAGCACTTGCAAATGAATCTCCACGAGGCGTGGCAATCTTTTCTTT
GAAACCTGCTCCTTCACACTCCCATTTCTGCCTCCCCATCCTGGTTTCTGAACTCATTTT
GGCATG


invisible?    
Gene introns: KIF13A (17763923 - 17987799)  

>18830 191 635     4q32.3    chr4:168509919-168510109 BLAT!
GGCTTTTAGACAACAACCACCCTATTCCATGGAATACCACTGTTGCAGTCCCACTCCCAC
TCCTGTAAGCAAAAGCTGAGTGGAGAACCTAGACTTCCACCTTTCATCTTCACCAGGCCG
TAACAAGACACTGTTAAAGACAAAATAATATTTAATAACACTTGTTAACGCATGGTTGGG
AAGACTGTATT


invisible?    
Gene introns: 0  

>24557 188 635     Xp11.22    chrX:52862409-52862249 BLAT!
AGCGGCCGCCCGGGCAGGTACGCGGGGGATGAAATGTTGAGCCGTGGTTTTAAGGATCAA
ATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCACA
ATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTG
GTGAAAAA


invisible?    
Gene introns: 0  

Shown 1201-1230 from 3142 sequences on 41 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs