Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1261-1290 from 3142 sequences on 43 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>13770 212 619     8q13.3    chr8:72023131-72022920 BLAT!
GATAACCAACAAATGGACAGCCTTGAGGTCCAAAAGAGAACAGTTATGAAACATGGAAGA
GTAAAACTAAGAAGATAATTACCTATCAGGAAATACATTTGTAGAAATTTTATGAGAAGT
GATTAATGTAGTGAAGAAATGCAAAGCATTAAAACAAAATGTTAGTGCTATAGTGAACAG
GAAACTAAGTTGAATGGGGGACTAATCAAATG


invisible?    
Gene introns: 0  

>32120 197 619     6q16.1    chr6:95081620-95081424 BLAT!
GTTCTCCAATACCTTTCCATACACTTAAATTAATTGCCAACATCTAGCAGTGACCCATAC
ATTTCTGCCTAATATGTCATCTGCCTTCCTTACCAACCTCATCTGTTACCTGCTCAACTG
CACTTTTTCTAATACATCTTTGCCTGATGCATTGAAAGTTGTCTACTCTTGCTGCACCCA
TGTCTTTCTTTGTTAAT


invisible?    
Gene introns: 0  

>9573 196 618     17q11.1    chr17:25265334-25265249 BLAT!
CCAATCCAATCTATTCCAATCCACTCCATTCCATTCCACTGCTTTCTACTCCACTCCGTT
CAATTCCATTCCATTCCATTCCACTCCAGTCAAATCCACTCCAATAGACACCACTCATCC
ACAGTCCACTCCAATCCATTCCATTCGATTCCTTGCCATTCCATTATATTCCATTCCACT
CTTCAGCATTCCACCC


invisible?    
Gene introns: 0  

>1181 178 617     Xp11.22    chrX:52862409-52862260 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGATGAAATGTTGAGCCGTGGTTTTAAGGATCA
AATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCAC
AATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATT


invisible?    
Gene introns: 0  

>28789 187 617     5p15.33    chr5:2108871-2109057 BLAT!
ACTGTTGCATCAACAGTAGAGATAAAATTAAAACATAAAAAAATTAATCCAAAACAAGGC
AGAAAATGAGGAAAATAGAAATCAAGTAGAAAACATGGACATCTTGCAAGGTGGTAGATT
TAAATCTAACTGTATCAATAATTGCATTAAATGGAAATAGTCTAAACAGGGTTTTCTGTT
AGGAGGA


invisible?    
Gene introns: 0  

>32557 183 617     7q32.1    chr7:128302483-128302665 BLAT!
TGAGCTTCCATGTGGTGTTGAGCCTGCAGGTGCACAGAAGTCAAGAATTGAGGTTTTGGA
ACCTCCACCTAGATTTCAGAAGATGTATGGAAATGCCTGGATGCCCAGGCAGAAATTTGC
TGCAAGGGTGGGGCTCTCATGGAGAACCTCTGCTAGGGCAGTGCAGAAGGGAAATGTGGG
GTC


invisible?    
Gene introns: 0  

>10082 175 616     14q31.1    chr14:82832229-82832403 BLAT!
CTCAAAAAATGGGTGCTTCATGAACTGACTGAAAATTTTTAAAAAATCGCCATTTTGAAG
TGTTGACTTCTCTTATTCTACACAACGACAATGAACCATTTCTTGATTGGATTGTGATGT
GCAATGAAAAGTGGATTTTATACAGCAACTGGAGATGACCTTCTCAGTGGTTGGA


invisible?    
Gene introns: 0  

>25870 157 616     1q25.3    chr1:185478663-185478507 BLAT!
GGGAAAGAAATAGAAGGAAACTTAACAGGAGATCCATGAACCTGCCAATAGTGCTGGCCT
AGATTTGGTCAAAGAAAAAGATGTGGTGCAGTGCTACACCCAACAACTTGATTATTCACT
TCCTTTCTTAGCTAATACTGGGTGGGGGACAGAAGAA


invisible?    
Gene introns: 0  

>7023 203 615     8p12    chr8:35831245-35831447 BLAT!
GTTAGATGAGGCTGAATTAAGACCTAGACCACCATAAGTCTGAATCTGAGTTGCATGCAG
AGGAAGAAAATAAAGTTTTGAGTCAGTCTTGAGGCTAAAGAGAACGGAGAAAAGCACATT
TCTTTGTTATTTACAGTTTAGATTTACTGAGCTGGAAAAGAACAATAAGGTAGGACCATT
GATTCAGAGATGCCAGGAATTCG


invisible?    
Gene introns: 0  

>15955 196 615     7p21.3    chr7:12060185-12059990 BLAT!
TGGTTGCAGAAGAATTCTGCAATCAAGCTGAAATTATCTGTAATTCCTTATGATCATTTG
AAACAGCATTATAAGGATCCTCAAAGAGTAAATTAACCTATACCACCCACTCGAGGTATT
AGCATTGTTAATCATCACAGAAGCTATGACAATTCCATCAACAGAATTATCTATTTGATT
GCCAGATTAACTGATT


invisible?    
Gene introns: 0  

>959 130 614     3p13    chr3:70183036-70183160 BLAT!
TGATGTGAGTTTCCTCATCTGTAAAGTGAAGATAATATTTTCTACCTTGCTAGGTGGTTG
TAAAATTAAACAAAATGGGCCAGGTGCGGTGGCTTACGCCTGTAATCCCAGCACTTTGGG
AGGCCGAGGC


invisible?    
Gene introns: 0  

>1840 118 614     8q24.13    chr8:126858941-126858825 BLAT!
TAGGCAATTGTAACACAATGGTTAAGTATTTGGGTATTAAAACATAGAAAAGATACAGTA
AAAATAGAATTTAAGGCCAGGTGTGGTGGCTCACACCTGTAATCCCAGCACTTTGGGA


invisible?    
Gene introns: 0  

>25846 179 614     5p13.3    chr5:31818952-31819130 BLAT!
GTGACCATGTGCCTACAGCTCTATCATGCTAACTCAACAGATATAATTTTTTGTTTCCTT
CTAATCTATGTTCATTTGCAATATATATATTTTCAGACTGCCTTTGTTGATTCTTTTCAT
TGGAAAAGATTGTTTTACCATGTGCATGAGATAGAATGGAAGGACAGTGAGTGAAAAGT


invisible?    
Gene introns: PDZD2 (31799030 - 32111038)  

>17383 138 613     18q21.32    chr18:57684595-57684458 BLAT!
GATTCACTGACAGTAAACGCTATGAAAAGGACTTCCAGAGCTGTTTTGGATTGCATGAGA
CTCGTTCAGGAGACATCTGCAATGCCTGTGTCCTGCTTGTGAAAAGATGGAAGAAGTTGC
CAGCAGGATCAAAAAAAA


invisible?    
Gene introns: 0  

>20012 221 613     8q12.3    chr8:63000760-63000980 BLAT!
ATTTGCTACAAAAATGCATCTCTTAAGTCTATCGTGAGTTCAAAGACTAATCAATGTCAC
TGTTTAGCTTTTGCATACCCCTTATCTCTGAAGAGGATTCAGATCCTACACGCCTTCCAA
AGACATGGGATAGTAGCCACCCACTGCATTCCTAATCATCCTACTGTAGAAATGTCTCTA
AACTGAGAAGAGAAAGGGAATGAGGATAGGCAGAAATGTCC


invisible?    
Gene introns: 0  

>21797 108 613     11q22.3    chr11:108953633-108953740 BLAT!
TTTCAGCTCCATCAGCTCCTTTAAGCACTTCTCTGTATTGGTTATTCTAGTTATACATTC
ATCTAAATTTTTTTCAAAGTTTTCAACTTCTTTGCCTTTGGTTTGAAT


invisible?    
Gene introns: 0  

>8095 179 612     Yq11.21    chrY:14916130-14916308 BLAT!
AGAAAGTTATAACACTTTTAAAGTCACACTAGTTTACCTTCAGTAGCATACAAAAGCCCC
ACTCCTTAATAGCTCAGACCCCGTCATGTCAGTTATTAAGTTCACAGAATTACACCTTGA
TGCATTTTATGTCCAAAAACATAAGCTGGTGATAGCCTTTTAATATAATACTGTTGTAA


invisible?    
Gene introns: USP9Y (14813159 - 14972768)  

>10074 132 612     14q21.1    chr14:38104256-38104387 BLAT!
GCTACATACAATAGATTTTCCTTCTCCTCTTGCGTTTTCTAGATTGTGTTTGATGATTGA
TGCTAGAATTATAACACTGTCTGATGTGGCTCTAAATGCTGGTAGAGGAAATATTTAAGA
AAATTACAGATA


invisible?    
Gene introns: 0  

>25209 175 612     1p36.21    chr1:14550566-14550740 BLAT!
ACTTCCATGGAGAGAAATTTTTTAAAAACTTCAGGGGTGAACAACTGCCAAAAAGGAATG
TCTCATACCCAACTGTCATTGATTTTTATGTGAAAGTCAGTAGTTATTTCGGTGTAATGC
CCAGGATGCACATGAGAAGCTCAGATTTCATAAAGGCCAAAGGGGCAGGGTCTAG


invisible?    
Gene introns: 0  

>26577 215 612     6q15    chr6:92000417-92000203 BLAT!
GAATGTTTGTCCATGCCAATGCAGAACAAGAGCATGCTATTTGAATAGGCTCTATTGTCA
GTTTTTCCCAACCCATCTGCCATTTCTGGCCAGCAACAGTCATAATATAAGCCATTGTGA
TATTAAAAATGGAATGATTAAATAGAAATATCAAGCACTATTATTGCCTCAGAGATACTT
AATACTCTGACCCATGAAATAGCTTTGAGACAGGG


invisible?    
Gene introns: 0  

>32013 171 612     2q35    chr2:218144010-218144180 BLAT!
GAGGCCGACTCTGCAGTAACAAGAGGGTGAAGTGCCCCCTGATTCCCACTGGAGGAAGTA
GTTGGTTTGTCTGAATACTTTTGTAGGCTTGCAGGGAACTAAAATTCACTAGGTTGAAGG
CCACGTGGTGTGCAGCTGGTCTACATGAGAGGTGAGTGAAGGGGTATATGT


invisible?    
Gene introns: 0  

>19220 198 611     2q22.1    chr2:140426351-140426179 BLAT!
AGCGTGGTCGCGGCCGAGGTACACCACCCTTGTGGTTGCGGCGGTAGTCAGCCCAGACGG
GGCGAGAACCATATCGCTCCTGGTATTCTTCTGATTCCAGATATTTCCAGGGCTCATCCT
TATAAGGAGAAATGGGAACTGAGGACAAAGAATCTTCCTCAGAGGGAGCTTTGGTGCAAA
GAGTCTGGAGGGGAACCT


invisible?    
Gene introns: 0  

>21920 181 611     12q24.31    chr12:121352474-121352641 BLAT!
AGCGTGGTCGCGGCCGAGGTACCCCAAGCTGGCAGCTCTGAACCCTGAGTCCAACACAGC
TGGGCTGGACATATTTGCCAAATTTTCTGCCTACATCAAGAATTCAAACCCAGCACTCAA
TGACAATCTGGAGAAGGGACTCCTGAAAGCCCTGAAGGTTTTAGACAATTACTTAACATC
C


invisible?    
Gene introns: 0  

>16873 124 610     2q35    chr2:220729071-220729194 BLAT!
CGAGGAGGCCTTGAATGAGAGGTGCAGACATACGTGATATAATTAGGCAGCCTTTATGAG
GCAAGCAGGGAGAAGTCATTAGGGCTGCTGTTTAACAAAGGGAAACTTCCTGCTCCCACC
CCCC


invisible?    
Gene introns: 0  

>1306 158 609     2p15    chr2:62576551-62576708 BLAT!
CAGGGTTAACAAGAATTTTGGCCAGAAATATAGTTATAATTAAGCATTATCGGGTGTGGT
GGTTCATGTCTGTAATCCCAGCACTTTGGTGAAGCTAAGGCAAGTGGATCACCTGAGGTC
GGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCC


invisible?    
Gene introns: 0  

>2886 159 609     6q16.1    chr6:96722228-96722386 BLAT!
TATTGATCACCTGTGTGAGAAGCATAACTAAAACAATTTACTTCACACATTTTAGTCTTT
ACATTTTATTCAAAGATATCCAGGCATCTCACAACATTACAGTTATATCCAATTAGAATA
AATTCATAGAGATCAAGATATACGGCAGACTCACATCAC


invisible?    
Gene introns: 0  

>8152 167 609     9q21.12    chr9:73202995-73203161 BLAT!
AACATGGCTTAGAGGTGAAAAGCACCTAAATTATGTTGTGACTTTACAGCGACTCCATTT
TCTTTCCTTTGGGTTTAGTTTTAAGCACATTTGGAAAGTAACCTTAGAAGTTTCATTCCA
GTATCTTAGGCTTTATTGATCTTATCGATCTTTGATCTCTGTGTTTA


invisible?    
Gene introns: TRPM3 (73149965 - 73483974)  

>23740 156 609     2q31.3    chr2:181781053-181781208 BLAT!
AGGAAAGAATAAAAGCGAAAAGAATGAAGAGTCATATGATTACCAACTTTTCCTTTTTCA
TATAAATTGAGTGTATATGGGTCTGGAACAACCTGAATTTCCATCAAGTCCTGGCTAACC
TCATTATGTCCTATGAATATTTTTGACTAATCCCAC


invisible?    
Gene introns: 0  

>30967 153 609     Yq12    chrY:59329185-59329337 BLAT!
TCGCACCTGTAATCCCAGCACTTAGGGAGGCTTAGGTGGGCGGATCACTTGAGGTTAGGA
GTTCAAGACCAGCCCAGTCAACACGGTGAAACCCCATCTCTACTAAAAATACAAAGAAAT
TAGCTGGGCTTGGTGGCAGGGGGCTGTAATCCC


invisible?    
Gene introns: 0  

>1532 103 608     13q31.1    chr13:82485213-82485111 BLAT!
GGCTGGAGTGCAGTGGCGCGATCTTGGCTCACTGCAAGCTCCACCTCCCAGATTCACGCC
ATTCTCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGG


invisible?    
Gene introns: 0  

Shown 1261-1290 from 3142 sequences on 43 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs