Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1291-1320 from 3142 sequences on 44 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>31794 192 608     10q22.3    chr10:79505988-79506179 BLAT!
AAGCAGCAAGCACAGGCTCTGTCCAGTGTCCACTGTCCAGGGCCAGCGGTGATAGTGGTG
CAAGTTGCAGCATCTATGCCAGCAGCGATGGCATTACTGTCTTCACTGAAGCAGTTCTAG
CCTATGATTTGGGAGGCTGGCCTTGAACATGAAGCCACCTAGCTTAATTTTCCGGTCTTA
TTGGTCAGAATA


invisible?    
Gene introns: 0  

>5977 180 607     15q14    chr15:35431288-35431109 BLAT!
ATGGGTCAGAAGTCTGAAATGAGTCTCACTAAGCTAAAATCAAGGTGTTGGCTGGCAGGC
CTACATGCCTCCAGGAGGTTCTAGACAAGAATCCAAATTCCTGCCTTTTCAAGCTTAAAA
GCCACCCACATTCCTTGGCTCAGGGTCCCATTCCTCCATCTTCAGCTAGCAACATCAGGC


invisible?    
Gene introns: 0  

>18036 170 607     14q31.3    chr14:86098969-86099138 BLAT!
GCAAAATTAAAAAAGACAGTCATTATTCACTATGTCATATCCCATATAAAAATACAGCAT
ATATCATTTAAAGGTTCACATTGTGTTATCTTGGTTATTGCCATGAGAATAGTCTTTCCT
AGAAATGATATGCTTGTAAAGAAGGGAGTGGAGAGTGGTAGTTATTAAGA


invisible?    
Gene introns: 0  

>19876 135 607     8q24.13    chr8:126858858-126858724 BLAT!
GGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGGGGAGGGTGGATCACCTGAGG
TCAGGAGTTGGAGACCAACCTGGTCAACATGGCAAAACCCCACCTCTACTAAAAATATAA
AAATTAGCCAGGCAT


invisible?    
Gene introns: 0  

>2966 199 606     8q24.12    chr8:121855394-121855196 BLAT!
GAAGGGTTCAGGCTTTACACAATGGTCTCAGCTACAATCTTTTGTTTCATACGAGCCCAT
TTTCTCCTGAGCCAGTGTGTAAGCCTAGCACCCTAGGTTACCAAGGCAAGAAGCACCCAC
TCTAGGACTTGCACAGTTTGACGATATTGACACACTCTTTTATAGCTCTCTGGGCATCCA
GTGTCTTCCCTTATTTACT


invisible?    
Gene introns: 0  

>24703 172 606     1q41    chr1:219401470-219401641 BLAT!
TTTCCTGGCTGTTTCTTGAGAGTGAGAAAACTTCCCTAAAGGTTCCCGTAAGACCAACTC
TCACATCTTATTGGCCAGATGTGGGTCACATGCCCATTTCTAAACCAATCACTGATGAGA
GAAGTGGAATTATCATGCTTTGCTTAGCCAGAGTAGAGTTTATTACCTACAA


invisible?    
Gene introns: 0  

>30953 205 606     11q14.1    chr11:81261835-81262038 BLAT!
CTCTTCTGGACATTGGCCTAGGGAAAGAATTTATGACTAAGACATCAAAAGCAAATGCAA
CAAAAACAAAAATAGACACATAAAACAATTAAATCAAAAAGTTCTGCACAGCGAAAAAAA
TCATAACAGAATAAACAGAAAACCTATAAAACGGGAGAAAATATATGCAAAATATGCATC
CAACAAAGGGCTAATATCCAGAATC


invisible?    
Gene introns: 0  

>1259 145 605     2q21.2    chr2:135040368-135040224 BLAT!
TCTTGACAAGCCTCAAACCTGAAACAGCACCCACTTCCTTCGCTAATTTCTTACCCTACT
TTGCTGTTCCTCAAGCATTTTTCACCAGATGTGTTTATGTATTTGTTTCCTATCTGCCTT
CACTGCTGGAGTGTCATCTCCAGAA


invisible?    
Gene introns: MGAT5 (135011829 - 135206468)  

>4843 228 605     12q21.31    chr12:80955887-80955660 BLAT!
TCCCAAGGCTGGTTCAATATTAGAAGATCAATCAACATAATCCACCTTATTAACAAGCAA
AGATGAAAAATTGCAAGAATACTATCAATCAATGCAAAAAAAAGCATTTGACAAAATTTA
ACCCCCATTTAAGATAAAAATTCTCAGAAAAATACAAGTAAAGGGTAATTTCCTCAACTC
GATAAAGAGGAACCTACAGCTAACATCACAAACAATGGTAAAAGAATT


invisible?    
Gene introns: PTPRQ (80838125 - 81073968)  

>11926 157 605     6p25.2    chr6:3789809-3789965 BLAT!
ATTCCTTCACTGCTGGGTCTAGGAGCAGTAACTGAATTACTAGAAAGCCTTTCACGCTTC
CTCTATGCAGGCCAGCTTGGGAACTTTGATAAAGAACCTTGGGAAAAAGCAACCACTGTA
GGGCTCACAGCCCCTCAGCAGTAAGGCCAATAGCCCC


invisible?    
Gene introns: 0  

>32897 190 603     11q22.1    chr11:97566662-97566473 BLAT!
TAAACATTAATCTGTGTTCTTTCAGGTGGCACAAATTTAAAAAGAAACAAAGCAAAAACC
AGATGTATTAGTGGTAAAAATACCATCATATACTGGAAACATTTCATAAACTTTTCCTTC
ATTGCTGCATTTGCTTTCTTCACTCCTGCTGAATAAATTATTTTCCTAAATTTTATATTA
TTTTGTTCTT


invisible?    
Gene introns: 0  

>20082 149 602     13q32.3    chr13:101534214-101534362 BLAT!
CATCTCTAGGAGGTCTTCGGATGAGCCTTCCCCCAGGGAGGACACTGAGGACCAGGCATA
ACTGGGTAGAGAGGGAAATTAATGCCCTTTTCTTGAGACTCTTCTCCATGCCTGAGTGCC
AGCCTTTCTCTGCTTCCCTTCAGGGACAT


invisible?    
Gene introns: 0  

>14635 184 601     4p15.33    chr4:11604298-11604115 BLAT!
ACTAATTTCACCAATGAACAATTATTTCTAATATGTCATATTTGCCAATTAATCCAAATT
AATGGTTTCTTTTGGATAGCCTTTGATAATGATATCTGAAGCACTTATAGACAACCACTA
TGGGCTGTTGGTTTCTGATTCAGCACTTCCTATGCAATTTAACTGCCACCAAATTGTAGA
TTAA


invisible?    
Gene introns: 0  

>16878 169 601     11p12    chr11:39130597-39130765 BLAT!
ATCCAGTATTACCTCATCTTAACTAATTACATTCACAAACACCGTGTTTCCAAAAAAATG
TCATATTCTGAGGTTCCAGATAGACACGAATTTGGAGGGGGCTGCTATTCAACTCATTTC
AAACACCAAGCAAGATCAGTTTCCCTCATTTGAATGTTTCATTAATACC


invisible?    
Gene introns: 0  

>32379 178 601     7q33    chr7:137853092-137853269 BLAT!
CAAGAATCGTTTAGTTTTGGGGGAAGGTTATTATCATTTAAACTATAAACTAAGTTTCTC
CCAAAGTTATCTTGGCCCACACCCACGAATGAGCAAAGCCAGCCAGCCTGTGAGGCTAGA
AGCAAGATGCAGTCAGCCACGTCCAATTTCTCTGTCATACTTTTGCAAAGCCAGTTTC


invisible?    
Gene introns: 0  

>14297 186 600     2q24.1    chr2:158067873-158067986 BLAT!
AGGCGGTTCTATTTATACCATCTTTAGCTTCTGATCTATGTCCAAGTTTGATTTTCTTAA
TGGCGACAATTTGGTTGGTATTCTTATCTCTAGCCTTGTAAACGGTGGCAAACTGTCCCT
CCCCAAGGAAGTCCAGCTTCTCATAACGCTTTGCCCGAGACTTCACGTCCAGAGCCATCC
GGCGCC


invisible?    
Gene introns: 0  

>13017 196 599     8q24.21    chr8:130771739-130771934 BLAT!
TAAGAAGCTCAAATGACTATATAGAAATAAATCTAATAATCTGATTGAAAATGGGCAAAA
GATGTGAGTAGACATTTCTCAAAAGAAGACATACGAATAGCAAACAGACATATGAAAATG
TGCTCAACATCACTGATCTTCTGAGAAATGCAAATCAAAACTACAATGAGATATTATCTC
ACCCCTGTTAAAATGG


invisible?    
Gene introns: GSDMC (130760441 - 130799134)  

>1716 143 597     8q11.23    chr8:55435774-55435635 BLAT!
GATCTGGAAGGGGTTAATGGTAATAACTGGAAGTGAAAGTCCGATTGTAGTGGTGCTCAG
TGGCAGCATGGAACCTGCATTTCATAGAGGAGATCTTCTCTTTCTAACAAATCGAGTTGA
AGATCCCATACGAGTGGGAGAAA


invisible?    
Gene introns: 0  

>25316 162 597     12q24.11    chr12:110114005-110114166 BLAT!
GGCCCATGCATGTAATCATTGTATTTGGGGAGGAGGTAGGATTGCTCTAGGCCAAGCGTT
TGAGTCCAACCTGGACAACACAGTGAGACTTCATCTCTACAAAAAACATTTAAAAAGTAG
CCGGTGTGGTGGTGCACACCTATAGTCCCAGCTACTCTGGAG


invisible?    
Gene introns: 0  

>19849 198 596     13q33.2    chr13:105492122-105492319 BLAT!
TGGATTGGTAGAAAGATGAATGAGATTATTCTAAAACTCCTGTAGGGTCTCCAAATACAC
TCTATAGGTAGGTGAATCCACCACCCTGCTGGCAAGGAGCTTGAAAGCATTTCCATATGT
AGTCATTCTGTCACTTGTAAATCAAGACACACTGAGTATTGACTCAGTGTTGAGTTGAGC
ATCTTGCAAACAGCCTTG


invisible?    
Gene introns: 0  

>18841 165 595     2q32.2    chr2:190110902-190110738 BLAT!
ATGTATTGGTGAATGATTGGAAAGTTCCACATTACATACTTTTTTCTAGGAAGGTTGAAA
TGTATGTTTTTTTTCAGAGATAAAATAACGTATTTCTGTTTACAATAACCAAATATGAAA
TTGTGAGTATTTGCAATGGTGCCTAAGTAAAATTGACAATGTCAA


invisible?    
Gene introns: 0  

>12789 170 594     10q25.3    chr10:115226569-115226400 BLAT!
GCAGTGTTTACATAATTTACATTTAATATAATTGACAATGATTGAGTTTAAATATACCAC
TTTGTAATTTCTTTTCTTTTTCTCCCATTTATTATTTATTTCTTTTTTCTCTTTTCCTGC
CTTCTTTCAGACCAATCAAGTATTATTTCACACTACATTTTATCTCTACT


invisible?    
Gene introns: 0  

>33127 198 594     6q22.32    chr6:126945504-126945701 BLAT!
AAAGTGACAGAATAGTGAATTCTGTCCTCTCAGCCATTTACGAGAAGTAAAAATATAGCT
GCTGTGGTCTTCATGGAAAAGAGTGGAGAAGGGATATCGCCCTTATTTTTCTCTACTCTT
AGAGAGTGCCTGGCCTAGAAAGGCATGCAACAATTAGTTCAAAGAAACTTGTTACATAAA
GCAACAGCTTCAGCTGTC


invisible?    
Gene introns: 0  

>22947 189 593     3p26.1    chr3:5885543-5885731 BLAT!
TTACAGCCTTAGAGCCAAGTTTTTAAAGCCTGTCATTTTCCATTGCACTGTAATCAGGCA
TCTACCTGACAAACTATTTCTATACCTCTGTGTAAGGAAAGTTGTGGATGTGGTCATTTC
ACCTTTGGGGAACTCTTGTAGACTTTGTCAGATGCTAGTTGAATCTTACCATCAGTAAAG
CTAGAATAT


invisible?    
Gene introns: 0  

>4974 226 592     6p22.3    chr6:23862456-23862681 BLAT!
TAGCTGACGACAAAGGTCATAATGTCTTGGGAGCTCTATGGCCCTGCCTGAGAAACCTGA
ATGCTTAACCAGGTATCCCTAGAGCAAGTTTGCATTCTCCTTACAGGACCGTAACTGATG
CACTCTTGAAAGCACCACCTCCTGGCTAGAGGGCAACCAACACAAAACCAGTGCACTAGA
CAAAAAACAACCAAAGACCTTCACAGGGTCCACTTCACTCCCCTGC


invisible?    
Gene introns: 0  

>7865 197 592     5q13.2    chr5:72401668-72401472 BLAT!
AAAAGATCTCTCTATCCATCTGCTTTTCTGCCTAAAGATAGGATATAAAGTCCACTTTAC
TGGAGATAGCACTTGTCAGCCCAGAAATAGCACCAGAAGAACCTACAAAAAAGCCTTATT
CTGTTGGTGTATTCCCACAGATTTATCTTGCTACAGTTTCTTGCCTTTGGAAATCTAAAA
CTGCTTTCCTATGTCCT


invisible?    
Gene introns: 0  

>25200 178 592     10q21.1    chr10:54675795-54675618 BLAT!
AAGTCATCTGTCTATACCTTGAGCTATGGCATCTCTGGGACCCAAGAAAGGTTAGACAGT
TGGAGAATGTCACCTTCATGCAGTAGGCATGACAAGATTGGGTGATAGCTATTTTTTGCT
AGCCATAATATTTGATTTTAAAAAGTAAACAATAAAATATTTTGCCCAATCTCTATTC


invisible?    
Gene introns: 0  

>29947 179 592     3p14.1    chr3:63990704-63990526 BLAT!
TAAGAGATATTCTGGTCCATGGTCTTTGGATGTAGAAAATGAGGATAACAAGTGCCAAGA
ATTACAGCCTTACAAGGTGAAATACTACTTTAATTAACTTCCATTAACAACAGGAGCAAG
AACTTCTTACAGAAAGAGGAGACTAAGAAAGGAGTGAGAAGGGAGAGGAACTTAAGAGT


invisible?    
Gene introns: 0  

>4085 181 591     3p12.2    chr3:80575742-80575562 BLAT!
TGTGCCATACTGCGTTGGCTTTTTTTTGGGAATATTATAATGTGAACTTTATACAATACT
GAATGTTCACGCTGTGTTCTGTGGACTTTTTGAATATTATAATATGAAGACTCTGAAAAT
CAGATTCTTCATCCCCAAGAAGTATATTTTTGCTGCTTGTTGTGGGTGGTGGTTGTTTTT
T


invisible?    
Gene introns: 0  

>5241 162 591     5q32    chr5:147307906-147308067 BLAT!
TCTGGGTGGACCAGCTCATCTTCCACATCATCTTTATTATCATTATTTTCATACTCATCC
TCTTCCTCTTCTGAGTTGGCATTCATTAGCTTTCTTACCAAATCCCTCTAAATATGTTTT
GCTGCATCAGTTGAAAAATATACTTTCTCTAAGAATGTTTAG


invisible?    
Gene introns: 0  

Shown 1291-1320 from 3142 sequences on 44 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs