Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1321-1350 from 3142 sequences on 45 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4676 189 590     17q21.31    chr17:42109629-42109817 BLAT!
TTAGCTTCAAATATGTCAGGGAGCCTTTACCCTCCTCAATCAGTAGTTCACAGGCTGCAG
CTACTGAACTCATACTGAAGTGCTTGAGCAATTTTCAAATTTTCAAAACACCAAACAGAA
ATCAGTAATGAGCTGCTGAGACTTGAACGGCACAGATTCAGTATCAACTCACTGTGGTAA
GGCTGTTTA


invisible?    
Gene introns: 0  

>11727 181 590     13q21.1    chr13:57419903-57420083 BLAT!
AATCTTCAAGTTTAGAGGAGAACTCCAAGCCCCAGATGAGACTGCAATTATTTCCAAAAC
CTTGAGTTCATCCTGGTAAGATTTAGAGCAAAAGACCCACATAGCTTATGCTTCTACTCT
TGACCCAAATAAATTGTGAAATTATACATCTGTATTGCTTTTGTTTTGAATTTCTAAATT
T


invisible?    
Gene introns: 0  

>19244 161 590     5p15.33    chr5:3095928-3096088 BLAT!
GGCAGGAGTAACGAGGGACCTCTGCATGGGGAGTCTCTGACAGACTTAGTGAAACTTGTT
TTCCAAAGAAAACAAGCTCAGATTTGGCATCGCAATGCACGTGCTGGGTCTTTGGGATGG
ATTCTTGCTGAGAAAACTGATTCTGAAAAGGTCACATGATT


invisible?    
Gene introns: 0  

>27300 200 590     8p22    chr8:14071664-14071862 BLAT!
TTACTTCTGTCCTCCCCAGAACACATTACTTCAGTGTAATTATCAGAAAAATGTCAGACA
AATCCCAATCGAAGGGCAGTCTACAAAACACAAACCAGTAATTCTCAAAACTGTCAAGGT
CATCAAAATCAAAGAAAGTCTGTGCAACTATCATAACCAAGAGGAACAGTAGAGACAAGA
CTACTAAATGTAGTGTGATA


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>28435 161 590     2q22.1    chr2:141583281-141583121 BLAT!
AAAAAAAAATTCCACAATTGATCCTTCTTTTTAAAATCTAAATTCATCAAAATACATGAA
TTATGATTATGTTACTACTAATATTATACACAGCTACTAGCTTAATGCGTTAAATGCATT
ATGTTGGGCACTATGGATGATACAGAGGACTTTATGTAATA


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>21532 169 589     Xp11.4    chrX:40936869-40936701 BLAT!
GCGATATTTTTTGGCCACCACCTTGACAATATGCAGTTTGGGCAGCAGGTTGCAATCAGC
TAATGTCATTTCATTGCCATCCAGAAATTTACGTGTAGAAAACTTTATGTCCTCCATACT
ATTTTCATCAATTTCATCAGGGAGAGGAGAATTCAGATATTCATCCAGT


invisible?    
Gene introns: 0  

>28256 126 589     4q32.1    chr4:159675049-159674924 BLAT!
GGCGGATTACCTGAGGTCAGGAGTTTGAGAACAACCAACATCAAGAAACCCCGTTTCTAC
AAAAAATACAAATTAGCCAGGCGTGATGGTGCATGCCTGTTATCCCAGCTACTCAGGAGG
CTGAGG


invisible?    
Gene introns: 0  

>18117 198 588     3p12.1    chr3:86928825-86929022 BLAT!
CCTTGAAATATCTCTGAGGTTGAATGATTAATAAAGTTTTTGTGAAGAAAATTGTTCTAA
AAAATTGCATATGGTATTATGTTGCAGAAAAATAAGGAAGAGACTACAAGGGTGCAGTGG
AAAATGTAGCTCTGGGATAGTGGAAGAAGAAAGCAAGGGAGAAGGGGCAATGACAGAAGT
TAACTTACATTGTAGTAT


invisible?    
Gene introns: 0  

>18791 183 588     13q31.1    chr13:83291474-83291656 BLAT!
CACCATGTAGATTGAACATGTCTGCTGTTTATGAAATTCGTCATCTAATGACTCAGATGA
ATTGCATTCACACTGGCAATGAGATATTTGAATCAGCATTTTGAAACAATGAGGGTCATA
CAGTTAGAAATGCTTGATTAGCAGGACAAGGACTCATTTCAGTGGTGTTAGACAAAAACA
CTT


invisible?    
Gene introns: 0  

>30886 193 588     11p12    chr11:39133196-39133004 BLAT!
AATCAAGAAATTGTTTGTTGTTGCTGTGTAGAATAAGAGAAGATGACACTTCAAAATGAT
TTTTTAAATTTTCACTCAGCTCATGAGGCACCCACTTATTGAGCTTTTTCATCTTTCCAG
TTGGCTTCAAATGCAAAATAACCATAGAATGGCCAATGTTGAGTTCTTTGGCAACTTCTC
ATGTAGTTATCAG


invisible?    
Gene introns: 0  

>14650 154 586     8q13.2    chr8:68712867-68713020 BLAT!
ATAGAAAAAGGATGGTGCTGTATTTTGGTGATAATTGGTAATTTTTGGTAAGGTGGGGAC
AGGTTTTCCTAACCAGGTATCAAATAGCTAAATTAACTACAGAGATTCTAGTCCAAAAAG
ACTGGGATTCAATCATTAGCAAATATTTATTCAG


invisible?    
Gene introns: 0  

>16412 202 586     5q11.2    chr5:54153016-54153208 BLAT!
GGTTTTTTTCCAGGGAACCAATCTGCCCTTTTGAAGAAAAGACAAAGGTAGAAAGGATGG
TGGAGGACTACCTGGCAAGTGGTTATCAGAATGGGAAATACAACCTAGAACCAAACGGTC
ATCACTTCAGCAGGGTTTTTTGAAGAATCAAATATTCAGTGGGATACAAATGACAAGAGG
CTACAGTGGATGGAAACTCTGT


invisible?    
Gene introns: 0  

>31051 162 586     14q21.1    chr14:42566910-42566749 BLAT!
GAATTATAAGAGTGAACTTTTGCAAAGGGATTTGTCAGATATTCATAACCTCACAGTCAT
TTTTGTTATTATTGCAGTCACCTATGTGAGTTTGAATGTGGCTATTATAGTTGCAACAAA
GAGAAAGAAAGTATGAAAAAAAGCAGAATAAACCTTCAATCA


invisible?    
Gene introns: 0  

>20980 172 585     6q16.3    chr6:101141094-101141265 BLAT!
GTTACAGGTATTTATATAAAAGCATTTAGCCAAACCAACAAACTGAGGTGTTCAAGTTTT
GGTCTGTATAGTGAAGGTAGTATGAATTGTGAGAATCTCCATATGCAAGGAGTCCACAAT
CACTGAGAAAAAATAACAAAACTGAGGGTGGAAAGGCTGTGGGAAAAAAAAA


invisible?    
Gene introns: ASCC3 (100956607 - 101329224)  

>23886 207 585     22q13.2    chr22:41460383-41460177 BLAT!
GGCGTCTCTCTAAGAAATCCTCTATCTTCAGGCCCAGGATGTAATCCAGCTTCATCTTGC
CCTCATCCAGCACCCCAATGCGGACCAGCCGCCGCAGCAGGGCGTTGCCTTCGAACAGAC
GCCGTGGGTCCTTCTCATCAAGCGTCAGCAGTTCCCGGGCGGCCTTGCGGATCTTGGCCA
GGGTAAATTTGACCCTCCAGACCTCAC


invisible?    
Gene introns: 0  

>4873 174 584     11p12    chr11:39133663-39133836 BLAT!
AGAGTTTTTTGAATGCCAAAGAGCAGATTTTTTATGCTACAGGAATAAACAAACTTATTT
CTTGTTGGCAAAAATGTGTTGATTGTAATGGTTCCTATTTTGATTAATAAAGATGTGTTT
GAACCTAGTTATAATGATTCAAAATTCAGTCTGAAACAGCAATTACTTTTGCAC


invisible?    
Gene introns: 0  

>16118 176 584     11p12    chr11:42627062-42627237 BLAT!
CCACACTTTAGCAGAAAGCCAGGTTAATGTCTATAGTTCACTCTTTATACTACCTTGAAA
AGTCAAGGTTGTTGTGACTTGATACTATTGAGACACTGGCAAAACATCAGTTCCTTCCAC
ACACTTCTGATGGACCATACCCCATATCCAGATTCACAAAGGAGAAAAATGAGGGT


invisible?    
Gene introns: 0  

>24298 157 584     2q32.1    chr2:185869789-185869945 BLAT!
TGAACTTAAAAACATTTTTTTCTTGGATATCTCTTAGAAATGAGCTTTCAGAGCAAAGCA
CTGCCGTGAAATCAGGAGATACAGTTAAATTGACAGAATCACAGCTGATTTACCTATAGT
CTAAGCCACCAAAACCATAAATTGGCACAAAAATTAA


invisible?    
Gene introns: 0  

>28877 196 584     11q14.1    chr11:80104115-80103920 BLAT!
TGGTTACCCTACACTGTGAGCAGCCTGGTATTAGAGCCAGTCCTAGAATGTTTAGCATTC
AACTTTCATCCCTCCATAGTAGTGCTGATCTGAGTTCCTTGTCTGATTTTCTGACTTTGT
TCTGATTCCCTAGTGTCAAGTTGGCCAGACAGGGCACCACGGAGGAAAGTGGGATTGTCA
TGAGGGAGCTGCTCTG


invisible?    
Gene introns: 0  

>29100 213 584     12p13.2    chr12:10879849-10879637 BLAT!
TGTAAATTCACTTTGTTTACATGCCCTAGAGATCATCAGTGACATCATTATAGAGTTATT
CAGAATTATGGCATTATGGTTCATGTAAATTCTTTGGATATTATATGTCACAAAGGAAGC
TCAAACCAGCCCAACAGGTAGCATTATCTTGCTGGGTAGCCACAGACTGATGTATGGTCC
AGCTTTCAGGCCCAGGACTTTTTCCCAATGGAA


invisible?    
Gene introns: 0  

>2604 183 583     1q41    chr1:216394463-216394281 BLAT!
CCTGGTGCTTTATTCACTATTAATTCCTGTATCCGACAATATTTACTGAATCCTTACTGT
GTGCTAGCCTTTGTGTTAGGGACTGATGGAAAAAACTAAGACAAAAACAAACAAAAAAAC
TCTGCCGAATTTCTCCAATTTGCCTTGAAGTCTCATTCTCTTTTGTTTATTAATAATCCT
TAT


invisible?    
Gene introns: USH2A (215796235 - 216596738)  

>12483 161 583     4q35.2    chr4:189308980-189309139 BLAT!
ATGAGATAACAAGTAGGAACCCTCCTGCAAGCTACTTAGTTTCTTTAGAATGTGTTGGAG
GATGTTAAATAAATTGGAAATCTTGAGTGCTGAAAGCTTTTCTTTTAATTCTTCTGAGGT
AATTTCTTCCAGTAGAAAAAGTTTTGAAGTAAATGCATCGA


invisible?    
Gene introns: 0  

>9522 172 580     Xq25    chrX:127984704-127984533 BLAT!
AGCCTTTCTCTCCCTCTCTCTCTTGCATTCTACTTCTCTTTCTCATCATCTCTGCCCTCT
CCCCTTCAGGATTTCCTTTATTTCTCATGAGTTCAGCAATGCATTTAAAACTATATTTGT
TGTGGTTTATCCACAATGTAAATGTTTTAAAGGAGAAGGCTTTTCAGATGAT


invisible?    
Gene introns: 0  

>28319 158 580     13q12.3    chr13:31589079-31588922 BLAT!
AACAAAAAGAAAATAAATTAAAAATGTATAATGCTAATAGTAATATCTACAAAATACAAT
TTCTGGAAACCCATAATTTCTCTCTTTATGAGTCCAGTGAGATAAGCTGAGCCTCCAGGT
AATTTGGATATTCCAGCCCTCACTGTTGTGAGTCTCTA


invisible?    
Gene introns: 0  

>29685 196 579     2p24.3    chr2:14815638-14815443 BLAT!
ACATGTGTTTACCCAGGAAAAAAGCTCAGGCAGTATTCTAATGAGAGGCTTTATGCTAAG
AAAGAGCATAAAGACTGACCTTTGATTATTATACAAGTTTAATTATTTATTTATTTTTGA
AGCTAATTTTCTGATTCTTAACCAAGTGGCTGATATTGTGAAGGGGAGTTGCATTAGCAC
TTCCAGGACAGGGATC


invisible?    
Gene introns: 0  

>16403 170 578     8q21.3    chr8:92139337-92139168 BLAT!
AGGATTAAATTTTGTAAGCCATCTGTTAGAAAATAATTTTAGTCACTTTAGCCATCTGTT
AGATAATTTTTAGTCACTTTTCTACTTTTCTACATACCTTTGTTTTCCTTCTGGTTCTTG
CCTTGGCCAAGGCTCTTTTGGTGGTGGTAACAGAAACCCTCTTAAACTAG


invisible?    
Gene introns: LRRC69 (92114846 - 92231464)  

>24336 161 578     4q22.1    chr4:92143064-92142905 BLAT!
TCGGACAATATGTTTTTGCCATAATTTGCTCTTATAAGTAATTATCCATAGTATACCCCA
TTTTTCTGAGCATAACCTTATCACACTGGACTCTAGCTATTTATTAATGGACTGTTTCCA
GCATTAGAGCATATATATGAGTGCCGGGACTGTGTACAACA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>4937 206 577     6p12.3    chr6:47112174-47112379 BLAT!
CGAAATTCTCTAAAGGCAGTAAGCTTGGGCAATCGTAGGACTTACCTCATTTGTTTTCCA
TGTCTCAGGATTCACTGTCCTTCGTTGACTAATGTCCATTGTCTCAAAAACAGATGTTTC
ATATATTTCATCAGTTTTTTTAGTTGTTTCGTAAAGGAAGATAAATTCTCTCTTATCCCA
TCTTAGGAAAAAACCACAAGTTTTGT


invisible?    
Gene introns: 0  

>6210 155 577     22q13.31    chr22:45894249-45894402 BLAT!
GACTCCTGGGTCAGAGACAGGGACTTTATTAGTTGCAGTAAAATAATAGCTGCAGTTTAA
GCATGGTGTTCACATGAGTTCCTTGTGTCTTCCAAGTCCTAGGGTCGGTGTGGAGTGGGC
GAGGTCAAGGGCCCATCATGGATGGTGGATGCCTT


invisible?    
Gene introns: 0  

>13613 182 577     4q22.1    chr4:92892570-92892389 BLAT!
CATCATGACTAAGTGGTCTTCATCCCAGGGAGGCAAGGATGGTTCACCATACACAAATCA
ATGAATTTGATACATCATATCAATAGAATGAAAGACAAAAACCATATGATCATTTCAATA
GATGCCAAAAAACATCTAATAAAATTCAACATTGCTTCATAATAAAAACTCTCAATACAG
TG


invisible?    
Gene introns: 0  

Shown 1321-1350 from 3142 sequences on 45 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs