Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1351-1380 from 3142 sequences on 46 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>18004 138 577     4p15.1    chr4:29391081-29390944 BLAT!
CCGAGTAGCTGGGACTACAGGCGCCCGCCACTATGCCCGGCTAATTTTTTGTATTTTCAG
TAGAGACAGGGTTTCACTGCGTTAGCCAGGATGGTCTCGATCTCCTGATCTCGTGATCCG
CCCGCCTTGGCCTCCCAA


invisible?    
Gene introns: 0  

>18734 141 577     5p15.32    chr5:5917632-5917772 BLAT!
GCAGGAACATCAGGGTCTTCAGTCATCTCTTCCAGGATCGTCCCTTATTAGGCAAGATCT
TTCTTTACAATATAGATCTTTTTGAATATTTGTATTTTTACAATACATTAAACACGAATA
CTATGTTTTCAAGATAAGAGG


invisible?    
Gene introns: 0  

>8044 167 576     16q23.1    chr16:76198385-76198219 BLAT!
AGCTAATTCAAGCCTGTCTCTTTTGTTCTCAAAGAAGGTATTTATTTGATATCCCATTAT
TAAGCATCCACTATTTGCAAAGTCCTACTAAGAAAACAGAGAAGACTCAGCCATGGTCTA
CTGTTTTCTTGGAGTTCTCTTGGAGAGATAAAGACGGTGCTATTTCT


invisible?    
Gene introns: 0  

>27797 173 576     4p15.33    chr4:11884787-11884959 BLAT!
TTTTTAACATTCTCTCTCATATACTTTACTGTAATTACATCTAAACTACTTGTCACTCCC
CCAAATATACCATATTACTTTTAGCTTCTGCAACTATATATGTGATAATCCTGTCATTTC
CCCTTCGTTTCTCTTTAAAGGAAAATCATCAGCATTTATTGAGGGCCCATACT


invisible?    
Gene introns: 0  

>17223 195 575     Xq22.1    chrX:99374756-99374562 BLAT!
TTGTCTGGGGTTTATATGGAAATCCCAGGGGTCATCAGAAACCAGGTGCCTGTCAAACTG
AGGAAAGGAAGGGGAAGTGGAAGAGTCAGGAGGGAGGTTCTTGTTTATTTTTACTGATTT
TATCAGTGCACAATATTATAAAAACAATAAGAATACAGGAATAAAAAGCACAATATCACT
ACATATTAATTGTTT


invisible?    
Gene introns: 0  

>19821 145 575     6p22.3    chr6:22535298-22535442 BLAT!
TAATGGGTGATGTTTGGTGTGCAGGAGAAGATCCTTCATAAATAGATTAATGCTTTCCCA
GGGATGGGGGGAGTAAGTGAATTCTTATTCTGTTAGTTGCCATGAGTGCAGGTTGTTATA
AAGAGCCTGTTACTGCCCCCCTCCC


invisible?    
Gene introns: 0  

>28892 192 575     4p15.33    chr4:11604932-11604741 BLAT!
TTCTGAAGCCTATAAACCCAAAACGAGTGTCATGTGAGAAGACTTTGACTAGTGTCATAT
AAATGCCTGACAGAAATTTCGAATAGACGTCACAAACTGTCGATTCAGCCATTGTCATGA
TTTTTAAATAAATATTGGTAACCTCCTACGGTTAGAGATAGAAGAGGATATACATCCTCT
CCCTAACAATTT


invisible?    
Gene introns: 0  

>14653 101 574     2q22.3    chr2:146014523-146014458 BLAT!
AAACCACCAGTAGGAAACTGAAAAACACTCAGTGAGTACGCTTGATAGAATGCATATTTA
ATTGTTGTTGGGTGGATATTATAGAGCAGTTTTGAAAAGGA


invisible?    
Gene introns: 0  

>15797 164 574     6p22.1    chr6:27116726-27116889 BLAT!
AGATTTAAGAGGACATAGTTTGTAATTCAATACACATAGATTTGTTTGCTACTCCCAGTC
TTTGCATGCAGAAGCCCAATTGAAAAAGAAATGCAAGAGATGCAGAACGAGAAATTATAA
TGTAGTGACATATGAGTTCTCGATAAACAGATGCTGAGATGGAG


invisible?    
Gene introns: 0  

>980 146 573     15q14    chr15:35606033-35605888 BLAT!
TAGTTTCAGGTCTTAGATTTAAGTCTTAAGTCAATTTCGATTCAATTTTTGTGTATGAAT
AGCCCTGTGCACACACAACATGATCTTTTTTAGAAAAACCTAAAGATGCCACCAAAATAA
TGTTAGAACTGATAAATGAATTCAAT


invisible?    
Gene introns: 0  

>6370 156 573     14q12    chr14:26004921-26004766 BLAT!
GCACTACCAATCCTTTCCATCCCCATTAGCATGTAGCATTCTTGGTGTCCCGTGAGTATA
AAATTTCAGTAGATCCATAATGCATGAGAGTTCAGTGAGACTCAAAGTAAGCACAAGGTC
AGGGCAATACATCTATAACTGAGTAAAAAGGGGTGC


invisible?    
Gene introns: 0  

>20520 202 573     9q33.2    chr9:122523914-122523713 BLAT!
TGGCTCACACTTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGATGGATCATTTGAGGTC
GGGAGTTCAAGACCAGCCTGACCAACATGGTGAAAGCCCATCTCTACTAAAAATACAAAA
AAATTAGCTGGGTGTGGTAGCACATACCTGTAGTCACAGCTAGTCGGAAGGCTGAGGCAG
AAGAATTGCTTGAACCCGGGAG


invisible?    
Gene introns: 0  

>21604 198 573     7q31.33    chr7:126915314-126915511 BLAT!
AAAATGGGGGGAACCGGGTAAATGAGATCAGGATAGCAGGGTGGGAAGGCAGAACAAAGT
GGGCCTCTTTGGGACAGTGAGATTGAAGTTAACTTGAGTGGGGAGAGAATGAGCCAGAGG
ACAAGCGTTCCGGGCAAGGGAAGAGCTGAAGTGAAGGCCTCAAGGTGGAGGGAGGGAAGA
GGAAGCCTTGAAAGGCAC


invisible?    
Gene introns: 0  

>32549 238 572     3p14.1    chr3:67234271-67234034 BLAT!
AGTATGATCACTGACTTGAAAGACGGTGGGTGAGATAACATTTGAGTGTGGACCTTGTGC
TAAGCACTGTGTTAGGACTTTTCACACTTGTTATTTAATCCTCACAAACACCAAACTTTG
GTGCAAAAGTCATTGTGGTCTTTTCCCTTAAAGGTAATGGCACCTTTAATTAAGGTAATT
GCAAAATTAATGACTTTTGCACCAAACTAATATGAGTCCCATTCAATGGAGAAAGGAA


invisible?    
Gene introns: 0  

>17221 214 571     4q22.1    chr4:91476001-91475788 BLAT!
AAAAAGATCAGTAGCATAAACAGCATTACATTTTACTTCTCAGATATCTCCCTTAAAAAC
GAGGTATGATGAGAAGTCAAATCTGTTAGCTACTGGGCTAAGAAAAGTAAAACAGCATTC
ACTTACAGAAAGATAAGTTCCCTTACACACTGGCATGCATTTAAAGACTTCCTTAAAATT
TGGATATTCTCCGTTATACTTTAGCTCCTGTCCT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>24874 182 571     14q21.1    chr14:42526641-42526460 BLAT!
ACCTGTAGCCATTTGTTTTTCCTCATAGCATTCAAAATTCCAGGCATGAGGCAAGAAACT
GAAGATCTGGCAATGAGCCTAGAAAAAAAGGATTCTACTAAGAGGCAGAAAAAACAGAAC
CTTGGCAGTGTCATGGGGATAAGGAGACAAAAATTAGAGACTTGAAGTGTCAGGATCATG
AC


invisible?    
Gene introns: 0  

>19562 175 570     8q24.22    chr8:132476968-132476794 BLAT!
TTCGTTTGGTAAAATAATTATACCTGCATTTAGAGATGTTGTTAAAGATCAAAGGAGAGA
ATGTATGTGTTGTGTTCAATCTAGCACCTGATATATGGTAAATGTTAACTAAATGGTGGT
TGATTTATATTTTTAGATTATAATATTTTCTTCCACTCTTCTTTTGACAAGCACT


invisible?    
Gene introns: 0  

>21393 123 570     7p11.2    chr7:57772035-57772157 BLAT!
GGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAAAGCCCATATCTACCAAAAATA
CAAAAGTTAGCTGGGTGTGGTGGTGGTGGCGCCTGTAATCCCAGCTACTCGAGAGCCTGA
GGC


invisible?    
Gene introns: 0  

>31992 227 570     8p21.3    chr8:20479465-20479587 BLAT!
ACCCATGCCACACCCCTCCCCAAACACCACATATGCACCACATACATACCACACACATGC
CACACACCACACACAAACCACACACAAAAAACACACACTCCCCCCACACACCACACACAC
ACCACACACACCACACTACATACAACACACACATAGACCACACACACACAACACACACAC
CACACAAATACAAAACACACACCACACACACCACACAAATACAAAAC


invisible?    
Gene introns: 0  

>5002 172 569     20q13.31    chr20:55258211-55258040 BLAT!
CAGCTCCCTGCTGCCTACAGGAAATTGAACCAACTCCTCAACTGGCCTTCAACGTTATCC
TATTTCACCCCCACGGCACCCCTCCCAGCACTTCACCTCCAGAAGACAGGATTATTTAAA
ATTTCCCCAACCTTCCACCAACCCACACAATTTCCTTCCATGACACGCTGCT


invisible?    
Gene introns: 0  

>24730 121 569     12q24.21    chr12:115373924-115374044 BLAT!
TTAGAGCCCAAGTCATGACTTCTTTCCCGATTTCTTCTTTCCATTTATTCTTGGCCTGTT
CAGGAAGGAGATGGCAGCATCCATGGTTCTCTCATTTATCTTCTTAGTCATTTTGTTTAT
T


invisible?    
Gene introns: 0  

>29862 163 569     5q23.2    chr5:122095745-122095907 BLAT!
TAACATTAACTTGAATAGACTGAATTTTGCATAAATACAGACATTTTAATCTTCATCTCT
GATGCGACTCAAGAACATACATCACTGTTGTGTCCCATACATCACTGCACTGTTCACAAT
CTTTCTGGATAGATCTCCTGGTCATGGTGATGCAGTGGCTTTT


invisible?    
Gene introns: 0  

>10612 144 567     3p14.3    chr3:55240504-55240647 BLAT!
GATATTACATCTTAGTATTTAAAAATGTATAAAAATTCCTTTTTGTAATATCAAACTTTA
GACACATGTAAATAATTAAGCCTCTGTTAATGTAGTGGGGTCAAAAGGTATGTGCTTTGG
GAAACCTATTTAATTTTTACAAAC


invisible?    
Gene introns: 0  

>5006 157 565     3p12.2    chr3:83228042-83228198 BLAT!
CATGGACACTTGAAGAGAATGTGTTTTTTTTTATTTAAGGATAAAGTATTGTATAATGTC
AATTAGCTCCTATTGTCTGGAAATATTCACTTCTATGTCCCTATCGACTTTCTATCTAAT
ACTGCTCTCCATTGCTTAGAGTGGGCTGTTGAAGTCC


invisible?    
Gene introns: 0  

>6688 181 565     6p25.2    chr6:3828979-3828799 BLAT!
TTAAAAAGAAAGGACACTCTGACACGTGCGACAACATGGATGAACCTTGAGGACATTATG
CTCAGTGAAATAAGCGAGTCACAAAAGGACAAATTTTGTATGATTCTACTTACATGAGGT
GCCTAGAGTAACCAAATTGACAGAGACAGAGAGTAAAAGGGTAGTTACCAAGGGTTAGAG
G


invisible?    
Gene introns: 0  

>15784 146 565     1p36.13    chr1:19662339-19662484 BLAT!
GGAGTCTGTAGCCTGCAGCCCATGAACCCCAGGGGCTCCCATACGCCTTCGTTCTCTTCT
TAGGGATGCCCGAGGTGCCCTGCTGGACCCCAGAGCTTTCCTCACCAGGCAGCCAAGGAA
CGAGCAGGGAAAGGCATGGCTGGGAA


invisible?    
Gene introns: 0  

>16962 151 565     5p15.33    chr5:3095496-3095346 BLAT!
GTGAATTCCTTGGGGGCATCAAATTTGAGTGAAATAATACACCAGGTCCAGTCTACAAGA
CAGTGCTCTGTTTCTCTGATGACGCTGAAGTTGGCACCCAAGCTGCATGCAACGGGATGG
AGAAGGACCTCCTGAGAACGCTGGCATTTGC


invisible?    
Gene introns: 0  

>19508 204 565     17q11.1    chr17:25267654-25267593 BLAT!
ACTCCACTCCATTCCGTTCTGTTCCATTCAATTACTTTCAATTCCTTTCCATTCCGTTGC
ATTCCATTCTATTCCAGTCCAGTCCACTCCACTCCACTCCACTCCACGCCACTCCGTTCC
ACTCCTCTACACTCCACTCTACTCTGCTTCGTTCCATTTCTTTTCATTGTTCTCTGTTCT
GTTCTGTTCCATTCCACACCATTC


invisible?    
Gene introns: 0  

>18136 233 564     10p12.2    chr10:23414903-23414671 BLAT!
ATCATATACCTATGATAATGAAAGCATATCAAAATTTGTGGGATGTAGGGTAAAACAGAA
CATATAGGGAAATATGTAGCTTTAATGCCTACATGGGAAAAGAAGCAAAGTCTAAAAATA
AAGCTCAGTGATCTAAGCTTCCACCTTAAGAAATTATAAAAATAAGTCCAAGTTATGCTC
AAAGTAAACAAAAGGAAGGAAAGGATAAAGGGTAAAAATCAATAAAATAGAAA


invisible?    
Gene introns: 0  

>20519 176 564     7p21.2    chr7:14159383-14159208 BLAT!
ATGTATATACATTTTTATTTTAACAATGTATAACATTGAAAAATGTTAAAATCACAATCT
TTCCTTAGTCTATCTGAAAGTGTTTACATTACTAATACTACCAAATAAGTTAAACATGAA
ATAAAACCTTCCATGCTATGCTACTCACACCTTCCAGGCCATGCTAACCTCTGCAA


invisible?    
Gene introns: 0  

Shown 1351-1380 from 3142 sequences on 46 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs