Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1411-1440 from 3142 sequences on 48 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>6375 125 550     5q35.2    chr5:174667600-174667724 BLAT!
TTGGGAGGCCGAGGCGGGCAGATCACGAGGTCAAGAGATCGAGACTATCCTGGCCAACAC
GGTGAAACCCCGTCTTAACTAAAAATACAAAAATTAGCTGGGCAAGGTGGCGTGCAGCTG
TAATC


invisible?    
Gene introns: 0  

>14763 167 550     14q12    chr14:28497678-28497844 BLAT!
TGACTCAGCAGAGGAAAGTCAATGGAATTAAGTCTGTAGAAATTATATGAACAGAAACAT
ATTGAGAGAGAGAGAAAAAGAGAGGTGGAGGAAGTAGATCCAAAGCTTCTGGGACAATAT
CAAATGATGTCTCATTTGATGAGGGAAAAAATAGGGAAGATTAAATA


invisible?    
Gene introns: 0  

>25353 201 550     1p31.1    chr1:74299598-74299398 BLAT!
TTTTGAAGCTAATGTAACCAAGTTTTGAGCTCTTTGAATTTTTAGTGATTAAAGAGGAAA
CATATCCCTAATGATAGGGAAAGTAGGTTTTAAAATTATAATTTTATAGGAAAATTGAAC
AAAGAAATAAATGCAAGTCAATTACAGTGAAATGATTTCGGCAACGATGGCTTAGCTTTC
TTTCTCTACCACAAAATAAAA


invisible?    
Gene introns: 0  

>32590 182 550     13q33.3    chr13:108692469-108692650 BLAT!
AGAGACTGAGGCTCCAAAAGCTGTTCAGAAGCACTTCTCCTCAGAGGTCTAGGTCCCAGC
TCAGCAAAGCCTTCTCCAAGCTCAAAACGTTCCAGCCCCAGCCAGACAGTATCTCACCTA
GGACATCTCAGACTCAGTTCATAGGACTCCTCAGCCAGTGCTGTAGGTTCTAATCCCAAC
CT


invisible?    
Gene introns: 0  

>3357 155 549     17q24.3    chr17:69571569-69571723 BLAT!
TAGCTAAGACCTCCAACCTCTCAGCATTAAAAAAGAGAGAAAAACAAAAGGAGGGGCAAA
TTCAAATAGCTCGTTCCTTTTAAGCCCTCACCTGACTCACTCACAATGCAAGATGGCACC
AATCACTAAGCACAAGCTACAAGTGGCCAGATCTG


invisible?    
Gene introns: 0  

>4532 138 549     16p13.12    chr16:12737847-12737984 BLAT!
TCCAAAACCAAGTGAAGAGGGATGAGTGTGGAGGGGGGGAATATGACCGGGTGTTGCAAT
GTGGATTTCGTGGGATGAGCAAATAAAGCTCAGGAAGTCAACATCAACACAGAAGAGGCA
GCCTCACAGTGCAGCCCC


invisible?    
Gene introns: 0  

>22930 176 549     Xp22.13    chrX:17442466-17442641 BLAT!
AATTTCTCCTCATGAAAGACTAGACTTTAAGGAGAGATTCTGTGCAGGTCCCTACAGTGT
GGAGATGGATTGATTGGGCCTACAGATTGCAGCTAATCAATTCATCCTTTGCTTCCCAAA
GGTTTATGCATTTGGGTGGAGTTCACAATGAGTGGTCTGGGTGCAGGGCCGTGTGG


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>32098 202 549     10q26.12    chr10:122061623-122061422 BLAT!
CATCTTTCCCTTGACACATTTTTCTCTCTCTCTCTCTCAATAAGCTTCCTGCCTGGGTCT
GAGGAATTGAAGGCTTGAGGGTGTATCTTCCATTCCTGGTTCTCAGAGAAGCCCAGACCC
TAATGCATTTAGAACACAATTTCTTTTAACATTTGTTCTTTGCCTTCACATTAAATTAAT
CAAAAACCCATAGTGTGGTGTT


invisible?    
Gene introns: 0  

>24855 167 548     4q22.1    chr4:91390577-91390411 BLAT!
AAGACTATATGAAGAGCAGTTAAATTAACTGACTTTTAGATTGTATTAAAACTGAATTAA
AATCATTATTTTCTAAATTGGTCAGTGTTTCTTCCCTCTATAATAAGAATATTAATACTG
AATATCTTCATGCAATCAAATATATACATTGCCCTATTCACAAACAG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>13186 135 547     8q11.23    chr8:55435634-55435756 BLAT!
AAAACAACAATTTCTCCCACTCGTATGGGATCTTCAACTCGATTTGTTAGAAAGAGAAGA
TCTCCTCTATGAAATGCAGGTTCCATGCTGCCACTGAGCACCACTACAATCGGACTTTCA
CTTCCAGTTATTACC


invisible?    
Gene introns: 0  

>24366 192 547     2q36.3    chr2:227314384-227314193 BLAT!
TGCAGTTTCTAGCAGGTTGCTCATGATTCCAGCCAAAACTAAAGGAAGAAACTCTCTTAC
CATGAGGAAGAAGAGATTTGAGAAAGGGCATGATTAGTAAGCTTCACCTCACTATTGAAA
CTGGCAATTCAGATTATTTAGTCTCCATGTAGGTTGCACTTCTCAGAATTCTTGAGCATT
CCAGAAGCCATT


invisible?    
Gene introns: 0  

>14588 177 546     3p21.31    chr3:46103532-46103356 BLAT!
CTGACACCTCCAAAAGCTTATGGCACTCCCTTCATGATCCTTTGCCACACAAAACCCTTC
CCTTAGGGGTTCCGGGGATGGAATCCATCCCAGAGAAGATACCTTCTATGCCAGACTCTT
CAAATCCAGCTTTGCCCACAGTGCTGGACCTAGCTGGGCCTCTGAATTCAAGCCCCC


invisible?    
Gene introns: 0  

>16429 101 546     19q13.41    chr19:52420506-52420402 BLAT!
GCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAATATTAGCTGGGTGTGGTGGCG
CATGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGAATC


invisible?    
Gene introns: 0  

>8956 138 545     5q31.1    chr5:130977383-130977246 BLAT!
ATATATTAAGGTATACGTAACATGGACTGATGTCTGTCCAGACATCAGATGACAGAAGTT
ATGGACTGATATAACTTCTGTCAAACTTAGAAGTTTGACACTTCTAAGGATGTGACCTTT
CCTCATTGGTATTTCCAT


invisible?    
Gene introns: 0  

>9419 179 545     4p12    chr4:45683076-45683254 BLAT!
CAAGGGAAAAAGACCCACAGAGATGGTTAATATAAACTGATATCACAAAGGCCAGTCAGA
AAGGGTATTTCTTAGCTTTTACTACCAGAAAAAATATCAACAATTGATGATCAGAAGACT
GAGGAAAATTGTCTCAAACAAAAAGTTGACATCCCTTGCCCAGTTTTCAGATGTGAGCC


invisible?    
Gene introns: 0  

>22812 175 545     10q25.2    chr10:112774694-112774520 BLAT!
GGGCGTGGTGGCTCACACCTGTAATCCCAGCACTTTCAGAGGCTGAGGTGGGCGGACCAC
GAGGTCAGGAGATTAAGACCATCCTGGTTAACAAGGTAAAACCTCATCTCTACTAAAAAT
ACGAAAAATTAGCTGGCCGTGGTGGCAGGCACCTATAGTCCCAGCTACTTTGGAG


invisible?    
Gene introns: 0  

>30171 184 545     8q23.3    chr8:116012589-116012774 BLAT!
AATAAAAAATAATTATTATTTCACTATCTTTCCTCTTCCATGCTCTGATTATTGCCAAAA
AAAATGTATTGTTTCTGAGGGAGAACTCTATCAGAACAAAACAAAGACAGCATCAGTAAG
AAATAATGAAGTGAAGCCTTTCTCTCTCTTTCTCTCTACACACACACACACACAGTGTCA
TGCT


invisible?    
Gene introns: 0  

>10806 192 543     2q31.3    chr2:181771597-181771406 BLAT!
TTCCCCTGAGGCTCTAAACAGAGAACCAACGCTGAGGATGGGATTTCCAAGGAAATTATA
TCTGACAGATAGCCAAAAATGTGAGACAGACATTGAAAAATTATAATAACTTGAAATCCA
GAGCTAATACTCCATCAATTCCTACAGTGATTAGTTTAGTTTGACACTTTCAAAGCACAA
ATCTAAGCTATT


invisible?    
Gene introns: 0  

>12822 169 543     2q22.3    chr2:148329616-148329448 BLAT!
AACTGTGTCCTTGACCCTAAATCTTATACTTATTTGTTGAGGGCCCATTAACTGACTGTC
ATTGAGCTAGATTCTAGGAATCAGGAAATGAGAACACGAATCTCCAGGGCAGGCATGCAA
AGCACAATTCCATGTGGCAAACACTCTTAGGAGACACTTACCAAGAACT


invisible?    
Gene introns: 0  

>20683 181 543     11p14.1    chr11:30008741-30008921 BLAT!
AAATTTGTGGTAATTTTTAGAAGTAGCAACAGGAAACTAATTCCTGAATATGTTTCAATG
TGGCTTATATACAGATTAATCACAAAAAGAAAAATCTGGAAAGATTCTGTTATCGTTCTT
CTATTTGTCAATTTGATACATTGAAAGGTAAACATTTTCTGTTGCTAATGATTATGGGGA
A


invisible?    
Gene introns: 0  

>19082 199 542     Xq21.1    chrX:78345392-78345194 BLAT!
TTAGGCATCAAAGCCAGCTAATACCTCAGTGATTCAGAACTCACATATCCAGCAACCCCA
CCTATCAAAATACAGCTGACGGAGCCAGAAAGCAAGCACAATTAGTCCCGAATTGACAGA
ATAGATGTCATAAAGTTCATAAACTAAAACCCACACTCTGTTCTATAGGAGATTTCCCTT
TTCTACACATATTATTTCC


invisible?    
Gene introns: 0  

>1129 138 541     14q21.2    chr14:44082931-44083068 BLAT!
TGATTCCCTAATAGAACCTGAATACACATCACAGGAAAAACAGTTAATAAAGGAGCAAGG
AGGTCAAAAATGAGGATTCTGATGATATATGGGATCAAAATTATATCTCCCTCAAACAGC
TCAATGAAAAGTTACAAA


invisible?    
Gene introns: 0  

>13985 142 541     2q21.1    chr2:130062172-130062031 BLAT!
CTTGGCTGAGAGAGGTAGCAATGACCCAGCTCCCCACCTGGCGTCCACTGGCACCATAGA
AGTAGGTGGCCTTGTTACCTGTGTGTTGTTACTAAAGTCCTGAGTTTCCACTAGGCTTCC
TCTGACACTATCCCACTAGGGC


invisible?    
Gene introns: 0  

>25081 170 541     2q32.1    chr2:184730368-184730537 BLAT!
ATGACATTGACTAACACTTTTCAAAATTTTCAGTTTTCTCAATTATAAAATATCTCCGCA
TCCTTTGCAAGATTTGCTGAGAATCAGTTTACTGGACAAAAGCACACCTCCACTGGGATG
TCTCAGCAGAGACCTGGTAGACCACAACCTGTAACTACTGTTCCATTCCT


invisible?    
Gene introns: 0  

>30896 204 541     3q25.31    chr3:156463861-156463658 BLAT!
ATTCTAGCCAGGCAGATATCTCTCACATGGAGATACTGTCCCTTGACTCATGAATGCACT
GTGGAATTTGCCCTGGTGCCTTCTGAAGGGTTAAAGAAAAGGATCCTATTCCTTACTAGC
AGTGATGCTGAGGCCTGAATCAAATTAGGGAAAAGGCCAGTCATGCTGTTGCCTGCTATA
TTTACTGAGATAATTTCTTAAAGC


invisible?    
Gene introns: 0  

>186 123 540     10q22.2    chr10:76471541-76471663 BLAT!
CATGGTGGCTCACACCTGTAACCCCAGAACTTTGGGAGGCCAAGGTGGGTGGATCACTTT
AGCCCAGGAGTTCGAGACCAGCTGGGCAACATGATGAAACGCCATCTCTACAAAAAAAAA
AAA


invisible?    
Gene introns: 0  

>2187 128 540     10q22.1    chr10:72655059-72654932 BLAT!
GGGTGAATCACCTGAGGTCAGGAGTTTGAGACCGGCCTGGCCAACTTGGAGAAGCCCCGT
CTCTACTGAAAATACAAAGATTGGTCAGGGGTGGTGGCGCATGCCTGTAATCCTGTCTAC
TCGGGAGG


invisible?    
Gene introns: 0  

>8226 152 540     5q13.1    chr5:67910032-67910183 BLAT!
ATTCTATGAGACCAGCATTACCCCGGTATCAAAAAAAAGCAAGGATACAACAAAAAGAGA
AAACTACAGGCAAATAACCCTGATGAACATAGAGGAAAAGAATCCTAAACAAAATACTAG
CAAACCAAATCCAATAGCACATCAAAAGTATA


invisible?    
Gene introns: 0  

>8356 195 540     10q21.1    chr10:54790153-54789959 BLAT!
ACTGCCTGTTTTTCTGTGACCAGTGGACCTTATCTATACTCCCAATTCCAATTCCTTGTA
AACATACTTTGTAAACTCCTGTGAGATCCTGTCTCCTTTGCCATGCTGCTGTAAGGTCCT
AAAGTAGATAAAACCTAAGTTGCAATTCCGGTTTTCCTCAAAATCTAAGACATGTCACAA
AATAATTTACTGCCT


invisible?    
Gene introns: 0  

>7340 110 539     3q25.2    chr3:154071005-154071085 BLAT!
CTGAGACCAATGACACTGGATGGCCAAATGTTCCACAGTAGTTGCAGCCTTTTGAGTCAT
TTTTCCAACAAGGTCAACCTGCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: GPR149 (154055460 - 154147504)  

Shown 1411-1440 from 3142 sequences on 48 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs