Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1471-1500 from 3142 sequences on 50 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>6313 133 522     15q14    chr15:39008540-39008408 BLAT!
AAGGAAACCCGAGCGGGTTGCTGCTGCTAGCTGCAGGGGCTTGCTTTTATTCCCTTATTT
GTCCCCTCCCATATTCCATTTCCGTCCTGTCAGAGGGCCCTTTTTTCAATCTTCCTTGCG
ATTGGCTACTTTT


invisible?    
Gene introns: 0  

>8736 125 522     11q12.1    chr11:59310393-59310517 BLAT!
TGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGTAGATCACGAGGTCAGAAGTTCGAGAC
CAGCCTGACCAGCATGGTGAAACCCAGTCTCTACTAAAAATACAAAAAATTAGCCGGGCG
TAGTG


invisible?    
Gene introns: 0  

>11512 179 522     9q22.32    chr9:98825276-98825098 BLAT!
CACACACACACATACTCAGGATTCCAGGAGACACAGTAAGAGAGGGCTGATGCGCCACCT
CAGGGCAGGTGGGGATTCCAATCGAATTGTTCCAGTGACTCTGCTTGGGACCTGTGAACT
GAAAGGTCACAGGGGATATTTGGAGAACTCATAGATGAAGGCATTAGGACTCAGAGAGG


invisible?    
Gene introns: 0  

>875 145 521     5q31.3    chr5:141436673-141436530 BLAT!
CATGAAATTGAATATTTCTGCTTTTGACAAGTAAATTTAAACAAAATTGTGGATTAGTTT
CAGTCCACTGCTGCCTGTCCCTTTTGAGTTGATAAGACCGGTCCTTTACCCCCAGCAAAA
TAGCTGAGCGAGTAAAAAAAGGGTC


invisible?    
Gene introns: 0  

>6087 161 521     20q12    chr20:38545002-38545162 BLAT!
TGAGGCATGTTGCAAAACACCAGCAAGAGATCCAAGGCTCACTCCTGAGGCTGACTCTGA
TTAGACCCTTGCTAACCACAGTTCAAGTAGATGAAAAGGGTGAGTGTATTCTGATGGAAT
TCTCCTTTGGTTTTCCCTCTGGGGCTGATGGGAGGGGACAA


invisible?    
Gene introns: 0  

>6219 181 521     5q22.2    chr5:112033355-112033535 BLAT!
AGGCGGAGCTTAAAAGAAGGGAAGCTTAGTGTATCATGAGTGAAATGTTGATACAGGCAC
AAGAGAAACAAAAAAAGAAGAAACATGTATAATTGGTGTCATAAAGATTTTCAAACTTGC
TCTATGACCAATTCAATTACTGCTGGAAATGGAATTCATACCTTCTCATGTCTGCCTTCC
A


invisible?    
Gene introns: 0  

>9721 133 521     8q24.13    chr8:127120141-127120273 BLAT!
CAAAAAGTGCACGAAGGATATGAACAGACACTTCTCAAAAGAAGACGTTTATGTGCCAAG
AAACAGGAAAAAAAGCTCATCATCACTGGTCATTAGAGAAATGCAAATCAAAACCACAAT
GAGATACCATCTC


invisible?    
Gene introns: 0  

>10685 164 521     5q33.1    chr5:150651591-150651754 BLAT!
GCGCCACTGCACTCCAGCCTGGGCGACAGAGTGAGACTCCATCTCAAACCCACAAACAAA
AAAACACCATTAGGCAAACACCATAGGAATAGTTGTTGCAGACAAGAAACACCTATGAAT
GCCGAATTAGTGAACAGAAGTATGATGGGAAACACGATTTTGCA


invisible?    
Gene introns: 0  

>27557 164 521     8q11.21    chr8:49347459-49347622 BLAT!
CACACTTAAATTCCTCCAGGGCCAGCTTCTCAGGCTGAGCGTTGCCTGCTCTTGGAGGAG
TTGGGATGGCTGTGCATGGCATTTGTGAGGGTTCCTGTGATTTCTGTGTTTTCTCCCCGT
GAGGGGTCCAGGGCCCAGGGTGGCAGTGGACAGCTGCAGGGATG


invisible?    
Gene introns: 0  

>20619 156 520     4p15.2    chr4:22667781-22667936 BLAT!
AGTAAAGGCATAGTGGCTCATACCTTTAATCCTGGCACTTTGGGAGGCCAAGGTGGGAGG
ATCACTTGAACCCAGGAGTTCTGGACCCACATGGGCAACATGGTGAAACCCCATATCTAC
AAAAAATATAAAAATTAGCTGGGCATGGTGGCTAAT


invisible?    
Gene introns: 0  

>7986 149 519     7q36.1    chr7:149786572-149786424 BLAT!
CAACTCTGTTCCTGAAGGCTTGCATATTGCATCACAGAACTTCCTCTTGGGATGGAGAGT
AATGTTGGGACAGATGACTGTCCTACTTTCTAGCAATGAAAAATGATTGCATGGAGCCTC
ACATTCCTGATGCTAATGAGAATCTGTCC


invisible?    
Gene introns: 0  

>20062 152 519     Xq27.3    chrX:142246740-142246589 BLAT!
CCTTCTTTTTTCTTCTCCCACTCTTCATGCATGCGCACGCTTTCTTGTCCTTTCACCTTC
TTCCATGCTAAGACACAGCAAAAATGCCCTTACCAGATGTGGACCTCCCAGCCTCCAGAA
TGATAAAAAATAAATCTATGTTTTAGAAATTA


invisible?    
Gene introns: 0  

>20355 146 519     2p11.2    chr2:84250044-84249899 BLAT!
AGTTCTACTTCCTGATTTTTTCTTTTTTTAAACTATGAAGTCCCTGTAGAACCCTTTAGT
GTTAGCTGCGATGCTATGCAACTAATCCATGGATCCGTTTTTGAAAGTTTCTTTTTAAAA
TTCTAGAGTTTCACAATGAAGTAAAC


invisible?    
Gene introns: 0  

>4848 209 518     11q22.3    chr11:106027184-106026976 BLAT!
GAGATAAAGCAGCTGCTTCAAAGAAACGTCAGCATTTGGAATCTTGGCGAAATCTTTTCC
CTGGCCCCATCTGCTGGCGATAAAGAGTAAAGTCATGTTTATAATTAAGCAAAATATAGA
GCTTTCAGTATGTGACTGTTCTGTGATCCAACATCATTTAAAGAAATTCATAGTATTGAA
AAGCAAGAATTAACTATCAATCTTCCTGT


invisible?    
Gene introns: 0  

>7109 206 518     16p13.12    chr16:14349272-14349162 BLAT!
ATCAATTAGTTGTTTGCTCTGTGTGAAATGTGTTTTTTCTCTTGATGCATTTAAGATTTT
CTCTGTCTTGTCAACAATTTGACTGTGATGTGATTTATCCAGCTTGTTTATGGCATCTCA
AAGCTATAAATTTGTCTTTCATCCTATTTGTGAACATGTCAGCCATTGTTTCTTCAAATA
TTTGCCTCTTCAGTTCTTTCTCTCTT


invisible?    
Gene introns: MKL2 (14165195 - 14360630)  

>4738 162 517     5p13.2    chr5:34324065-34323905 BLAT!
AACACACTTGCAATTTAGAAATCCTGTAAGGAAATGAAATTTGAGGGCAAAACTTAGGGA
AATCTCATTGTGAGCTATGGTAATAGCATTTTTTTTCTGACAAATCTAAAGTGTCTCAAA
GGAATGATGAAATCACACACACTTGTTTCTACTAGATCACGG


invisible?    
Gene introns: 0  

>16990 181 517     Un_gl0002290    chrUn_gl000229:12507-12687 BLAT!
AGCTAATGCTTTGTCCAATTCTTCAGTTAAGACAAACTCATGCCCTAATAGAGTATAGGC
ATAAGCGTAATTTGGATCAACTTGGATAGCTCTCTGGAAGAATTTAATTGCAATATCATG
TTCCCGTTGCAGACTGAAACAGTTCCCTGCAGCACACCAGGCCTCTGGCGAATTTTTATC
C


invisible?    
Gene introns: 0  

>21715 116 517     3q26.1    chr3:161048391-161048276 BLAT!
ACACAGATATGTTAGGTAAGTAACCCCAAGGTTACACAGCTAGTAAGTGGTAGGACCGGC
AGTGGAACCCACATAGATAGTCTGGCTCCTAGTCTGTGCTTTTGATCACTCCACTC


invisible?    
Gene introns: 0  

>23907 168 517     8q11.1    chr8:47212270-47212103 BLAT!
CCCAAATAATCCACAATAAAAACTAAAAGGAAGCTGTCTGTGAAACTGTTTTGTGTTGTG
TGGATTAAGCTTAGAGAATTAAACCTTTCTTTTGATTCAGCAGGTTGGAAACACTCTTTT
TGTCGAATCTGTGAAGGGACTTTTGGTGGCCAATGAGGCCTATAGGGA


invisible?    
Gene introns: 0  

>31261 178 517     10q25.2    chr10:112364562-112364385 BLAT!
TCCCAAACTCACATGTTGAAGTCCTAACCCTCAATACCTCAAATTTAACTGTATTTGGAG
ACAGGTCTTTTAAAGAGGTGATTAAGTTAAAATGAGGCCTTACATCCAATCTGATTAGTG
TTCTCACTGGAAGAGACTATGACAAATGAAAAGCCACATAAAACACTATATTAGTCAT


invisible?    
Gene introns: SMC3 (112327448 - 112364392)  

>54 124 516     3p21.31    chr3:48442989-48443112 BLAT!
CTGGTCTCAAACTCCTGACCTCAGATGATCCGCCTGCCTCGGCCTCCCAAAGTGTTGGGA
TTACAGGGGTGAGCCACTGCGCCTGGCCGACAGAACACTTTTAAAGAGAGATCCATAAAA
CATC


invisible?    
Gene introns: 0  

>25895 138 515     6p25.2    chr6:3789079-3788942 BLAT!
ACCCAGTGAGAGGCAGCTCTGCCCTGGCCCCAGGCTTTACAGGGCCCCAATCCAGCCCCT
ACCCACTGGGGTGAGGACGTCACCTGGAGCTCATGTGTCTTTCTGTAGACCACATTCCAG
GTAACTGGGACCCCAAAT


invisible?    
Gene introns: 0  

>27185 162 515     2q22.1    chr2:138427228-138427389 BLAT!
AGGCCAACCCAGTGTAAGGTAATTAGATAGTCTATCAGTCTATAAAAGCTTAGATGAATT
CTAGCTGTTAGTAGCCATATCCCCAAATCTAGATTCTATGGTTCCCATTTCCCCTAAGTA
TTTAAAAGATTAAAAATTTACGTGTAGTAACACATACATTTT


invisible?    
Gene introns: THSD7B (137748461 - 138435287)  

>32283 145 515     2q32.2    chr2:191653683-191653539 BLAT!
TGTGAGCCACTGTGCCCGGCCTGTTTTTCTTTTAAAGAAAAATGATTCTTAGGTTATGCA
GACCTCCTTGATGGTGTCCTTGGCCTGATCAAATGCAGACAACTTTGAGCATCAGAGATC
CCACCTCCCACACACCAACCTTATT


invisible?    
Gene introns: 0  

>540 145 514     Xq26.3    chrX:136876827-136876971 BLAT!
AGAGTATACATTCTTCTCAGCACCACATTGCACTTATTCTAAAATTGACCACATATTTGG
AAGTAAAACACTTCTCGGCAAATGCAAAAGAACAGAAATCATAACAAACAGTCTCTCAGA
CCACAGTGCAATCAAATTAGAACTC


invisible?    
Gene introns: 0  

>609 118 514     6p21.1    chr6:46004306-46004189 BLAT!
GGGAGGCCGAGGCAGGCGGAACACGAGGTCAGGAGAAGGAGACCATTCTGGCTAACATGG
TGAAACCCCGTCTCTACTGAAAATACAAAAAATTAGCTGGGCGTGGTGGCAGGCGCCT


invisible?    
Gene introns: CLIC5 (45866189 - 46048085)  

>27578 150 514     14q12    chr14:28497225-28497076 BLAT!
TCATTTAGCTATACCAGGTATGGTAGGATCTGATTTGTCTAATTTTTTTTCCCCAAGTGT
CTGCTATACTGTTAGCTTGAGATCTTTCTTTGTGCTACATACCAGAGAGATCTCTGGCAA
GGTATTTTGTGCTAGGTGATTTTCAGCTTG


invisible?    
Gene introns: 0  

>7625 199 513     1p35.1    chr1:34045255-34045057 BLAT!
GGAATGTCAAATTCAGTGCCTGAAGTCCCACTTGCCACAGTCCATCTCTTCTCATGGGTC
TCCTACTTGCAAGACCAGCCCATACTCAGTGGGTGGACAGTCTTAAAGAATCCCTGGGTG
TAGCTTTCAGGGGAGAGCCAACCAGAGGAAGCTGAGGGCCCCTGGGAGAAGGTGGGTCTT
GACTGTCTCAGAGCCCATA


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)  

>5414 192 512     2q34    chr2:210044385-210044569 BLAT!
TGATCATAAAATTAAATTTCAGACTTCACTAGTTCTGCGTAACACGACAGGTTGCCTAAG
GAACCTCAGCTCCGCGGGGGAAGAAGCTCGGAAGCAAATGCGGTCCTGCGAGGGGCTGGT
AGACTCACTGTTGTATGTGATCCACACGTGTGTGAACACATCCGATTACGACAGCAAGAC
GGTGGAGAACTG


invisible?    
Gene introns: 0  

>9852 171 512     6q16.2    chr6:100584159-100584328 BLAT!
GCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAA
AGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTC
TGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCT


invisible?    
Gene introns: 0  

Shown 1471-1500 from 3142 sequences on 50 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs