Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1501-1530 from 3142 sequences on 51 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>16757 173 512     5p15.33    chr5:3094687-3094515 BLAT!
TATGACCTTACCTGGAAATAGAGTCACTGCAAAAGAATTAGTTAAGATGAGGTCATATGG
GAGTAATCCAACATGACCAGTGTCCTTATCACAAGGGGACATTTGGACATGGAGAGGGAC
GCATACAGTGGGAGGGCTGTGTGCACACATGGGCAGAGATGGGCCGATGGCCA


invisible?    
Gene introns: 0  

>25044 119 512     6q22.32    chr6:126850364-126850482 BLAT!
CGGTGGCTCATGCCTGTAATCCCAGCACTTTAGGAGGCCGAGATAGGTGAATTGCTTGAG
GCCAGGAGTTCGAGATCAGTCTGGCCAACATGGCAAAACCCCATCTCTACTAAAAATAC


invisible?    
Gene introns: 0  

>10875 166 511     7q36.1    chr7:149782320-149782155 BLAT!
TCAAGCCTTATCTTCGTAAGTGAACTGCAAACTCAGTTTTCAAAGTGCCCATCTGACCAC
TCCACTCTGATGTCTAACATGTCCTCGCTAACATGTGGCCAGAAGAGAGCTCCTCATCCC
CACGGCCATTGCTCCTCCACCAGTGTTCCATCTCAGTAAATGGCAC


invisible?    
Gene introns: 0  

>26273 163 511     3p26.3    chr3:1492280-1492145 BLAT!
AACCTGGTAGTGAGTCTGTTTTGGCAAAATAATCCTCTTTGCACTCTTTCAGTCAAGGTC
AGCAGTTCTTCACATTAGCACCTTACAATTAATTCAGTGAGACTTTGAAAAAATAATTTG
TCTGAGATAGGGCCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>26702 159 511     11q22.3    chr11:106936316-106936474 BLAT!
CAATGCCCTGGAGGGCTACCGGTTTATCAATGTTATTACACAAATATGCATGTGCACACA
CACATACACTGAATAAAAGGTAGCCTACAAGAGTGTAATTCTTGACACTCTAGGATGTCC
ACACATCTCAAAGGGACAGGTATATTTCTTTGCAAATTT


invisible?    
Gene introns: 0  

>22474 141 510     15q25.1    chr15:78618179-78618039 BLAT!
GTTTTCAGAATGTTCAGAATTTCAGAAAAGGGGTTGTAGACCTATGTCTTAATAGCTCCG
GCGCCTTGAGCATAATGTCCTGTGTGCCTGGCATCATGCCTGGTGCTTCCCACATTTTAC
TCACTCAGCCCCCTCCATGGC


invisible?    
Gene introns: 0  

>85 110 509     1q41    chr1:221281184-221281293 BLAT!
CAGCACTTTGGAAGGCCAAGGCAGGTGGATCACGAGGTCAAGAGATGGAGACCATCCTGG
CCGACATGGTGAAACCCTGCCTCTACTAAAAATACAAAAATTAGCTGGGC


invisible?    
Gene introns: 0  

>5152 211 509     6p12.3    chr6:48161353-48161143 BLAT!
CTCGGAAAACAAAAAGCATCTGTGAAAAGAGGGAAGGAAAAGAGGAAGGAAGAAAGGAAG
GAAGATAAAGAAACATATCGATCATAATTGCTCCCATGGCAATCCATACTGTGCTGTTAG
GTAACTGTCCTTTTTGAATAAAGTTTGTTCTCATCCACCATTCCACCTCCACCATGTATC
ACCCATCAAAATCAGTCTCTTTCAGTGATAA


invisible?    
Gene introns: 0  

>5183 155 509     3p13    chr3:73317184-73317030 BLAT!
TGCAGAGAAAGGGGAACCTGCATATGCTGTTTGTGGAAATGTAAATTAGGACAGCCATTA
TGGAGAACAGTATTGAGGTTGCTCAAAAACCTAAAAAACAAAACTACCACATGATCCAGC
AATCCCATTGCTGGGTATATATCTGAAAGAGAGGA


invisible?    
Gene introns: 0  

>10326 217 509     2q32.3    chr2:196293614-196293398 BLAT!
TTAGTGTCTTCCCTATTTTTGTGGTATGCTTAATCTGTGCTAGTCGTTGGGTGTTGTGAA
CAGGCGTCCTCTTTGGTGTGACTTGCTATTTTCAAAGTCATTTGGGTAGATGCTGCTGAA
ATCCATCAAGGCTGCCATTTACTTTGGTCATGAAGTTTCTGTATTCTGAATTGTGAAGCC
TCCTCCTGACTTCTAGTCTCAGATGGTCCACTGTTCT


invisible?    
Gene introns: 0  

>20549 164 509     20q13.33    chr20:62761070-62760907 BLAT!
GCTCCGGCTCTGGCTGAGCATCCTCCACCCTCTCCAACCTTTGGCCACCAAGTGTCCCCA
AGCCCCTGGGATGCTCCCCATCACCAGTTTGGCCAGGTCCCACTGGCCTGGATCTTCCCA
CATGTGTGGTGATGGAGGAGGCTCAGAGGGGTCTGTGGAACGGG


invisible?    
Gene introns: 0  

>21614 167 509     3p14.1    chr3:65012587-65012421 BLAT!
ATACAAATGATCTCATAGCATGGTTGTAAGGGTTAAATAAAAGTTTAATATAAATGCTTT
CCACGGTATCTGGGTCATAGTAATCAAAAGTAGCGAGAATTGTCAGTGTATAATTATTGA
AGATTTTTGTCTTCAAAAACCGAAAACTAAATTTGATACACCTGGGT


invisible?    
Gene introns: 0  

>11739 156 508     8q21.13    chr8:84574296-84574141 BLAT!
AGGATCTGGCACACAGATCCTTAGCATATATTTCTTTGGTTTAATAAACAGTGGGATCAA
GGAGGCTTGTAACAAAGTATAGTGATGCATTATTGGAACTTCAGCTTAGAAACACATTAC
CGGGCTTTGAAGGGAATAGCCCAGATATGGTAGGTT


invisible?    
Gene introns: 0  

>17945 138 508     8p23.1    chr8:10304551-10304414 BLAT!
CTCCCAAGTCTATAGTATCCATCGGGACTTTTGCTTCAACACTCATGACAGTAATCTTTT
GTAAAATGCAACATTTTCCCTTTCAAATATTAGTTATAAGTATGACCCATCTATTCTCTT
AAAGGACATCCTGCGGAA


invisible?    
Gene introns: 0  

>9337 146 507     10q26.3    chr10:135386660-135386515 BLAT!
CATCTTCTCCCTATGTCTTCACAGAGCCATCCCACAGTGGGTGTCTGGGTCCTGAGTTCC
TCTTGTTAACGACATCAAGCTCACCTCACCTCATTTAACCTTAGTCACCTCTTTAAGGTC
CTATTTCCAAATGCACCCACCCCTGC


invisible?    
Gene introns: 0  

>13391 155 506     1p31.1    chr1:79215856-79215702 BLAT!
CAGGAGCTGCCCTGGAAAGATTCCGGTCATGCTGTCTCTCTTTTCGCCTGTCATGCCGGA
TTTCATCCCTCTCACGTGCCTCCCCATCCTCTTTTTCCACATGAGTTTTGATCCCAGCTC
TTCTCTCCCTGGCTTTCTGGGCCATTTCTCTAAGT


invisible?    
Gene introns: 0  

>17201 141 506     16q21    chr16:60943408-60943268 BLAT!
CTCAGTTTTATATATTGTGGTTGATGATCATATCTGCCTTGGGAGGGAGAATGGAAGAGT
GGCCAGGGTGACATTATTGCACATCTTAACCTTGACATTGCCTAGGACTGTGCAAGGCAT
AGTCTGACATGTGACGTGTGG


invisible?    
Gene introns: 0  

>4632 172 505     9p22.3    chr9:15150490-15150319 BLAT!
ATCACTTTGTCCCAGCCACACTCACCTTCTCCCTATTCCTGCCAACTGGGCTCACCTCAT
AGCCTTTGCACTCATCCTTTGCTGTGCCTGGAGTTGACTTCCCTCAAGTCTTTGCTTGAT
TCACTTCTTCTCATCAGTTGAGTCCAGCTGTCACCCCCTCAGAGGCTAGATT


invisible?    
Gene introns: 0  

>24705 176 505     18q12.3    chr18:40302484-40302309 BLAT!
TAGTAGGTCAGGCTTCAACTGACTCCAACCTTAATGGAAAGTTTATCTCTATGATATTCA
GGTTATACTGCCCGGATGTTCCACAGACTGCCTTGTCTGAGATCTCACATTGAGGAAAAC
ATTGAGTCTTCAAAATAATCTATATCTTAGAATTAATAATGGCAATGTAAATCATA


invisible?    
Gene introns: 0  

>30457 142 505     13q14.3    chr13:54528917-54529058 BLAT!
GTAAACGCAGAATGATGCAGTCACGATGGAAAACATTGTGGAGGTGACTTAAAACTTTTT
AAACAGAATTATGATATAATCCAGCAATTTCATTTTGGGGGTATTTATCCAAAATAATTG
AAACCAGGATCTTGAAGATATA


invisible?    
Gene introns: 0  

>5070 193 504     6q23.1    chr6:131049577-131049769 BLAT!
ATTCACAATTGCTACAAAGAGAATAAAATACCTAGGAATAAAACTTACAAGGGATGTGAA
GGACCTCCTTCAAGAAGAACTACAAACTACTGATCAAGGAAATAAGAGAGGACACAAACA
AATGGAAAAACATTTCATGCTCATTGGTAGGAAGAATCAATATCATGAAAATGGCCATAC
TGCACTGCGCAAA


invisible?    
Gene introns: 0  

>8792 247 504     11p12    chr11:42779376-42779130 BLAT!
ATTGCTTTGCTTAGAATCAGTCAGGTAAAAGTCCATGAAACATTAATTGCCTGGGTTCAG
AGGGACAGGAGATTACTGCCCATACTTCACTTCTTTGTAAAAAAAGAAGCTGTGTGTTTT
CCTCATAATTCTTTTACAAGATATTGACAAATATGTCATTTCTGCTTTTATCCATTATAT
CAAAGATAAGTTACTAAAGACTGCTTAAAAGGAAAAAAAAGAGCTGAAATTTGATATTCT
CTAATAC


invisible?    
Gene introns: 0  

>14349 206 504     5q12.1    chr5:60710326-60710121 BLAT!
AAAGGAAAAAAGATTTCAGCCATGCTATTTACCTGACCTCTCTACTGCATAGCTCAGACT
CAGGTCCAAAACTAAACCCTTGATTTGTCACGTCCCAAAACTGTTCTTTTCCCCCTCATT
CCCAGCTCCAATAAACAGTCACCACCCCTGATCCTCAAAATAGAAACCTCAAAATCACCT
TGGCTTCTTTCTTCTTTTTTTTCCCC


invisible?    
Gene introns: ZSWIM6 (60628099 - 60841999)  

>12754 143 503     12q23.3    chr12:108820651-108820509 BLAT!
AGCTCTACCCCTGCCCTTGCTACAATAGGTTCACTTGAGCCAGTCAATTCCTCTTTGACT
TACACTGATTTTGTTATTTGCAACCACTGGCCATGACCAGGAGGAGGGAGGGTCCCAGCT
AACCATGTTGTTTAATTCTGGCA


invisible?    
Gene introns: 0  

>8002 199 501     13q31.3    chr13:90680464-90680266 BLAT!
GAAGTCAAATCTTAAAGCTCCAAAATGATCTTCTTTGACTCCATGTCTCAGATCCAAGTC
ACACCAATGCAAGAGGTGGGCTCCCATAGCCTTGGACAGCTTTACCCCTGTAACTTTGCA
GAGAACAGCCCCATCTTGGCTGCCTTCAGGGGCTGACATTGAATGTCTGTGGCTTTTCCA
GGTGTAAGATGCAAATGGT


invisible?    
Gene introns: 0  

>20802 178 501     7q21.11    chr7:80984397-80984220 BLAT!
ATGTGTGGTGCAGAGTATGTGAGAACAGAAGACAGATAAGAAGTCCTGGAAAATCGAGGC
AGAACTAGCTTGTAGCTTCCGCTCCGATGAACAGAGCAGCGTGCAAAGACTCACATTGTG
AATTTTTTCTCCAAGAACTACTGCAGGAACATACCAGGAAAGCCGCGAGAATCCACAA


invisible?    
Gene introns: 0  

>9283 151 500     Xq13.3    chrX:74966505-74966646 BLAT!
GCAATAATCTTGCAGGACAGAAATTGGTTTACTACACCATATACTGCAGATGTCAAATTC
CAAATTCCTCTCACTTTGGATATAATCTTTATATTGCACACCCACCCCATCACAGTAAAG
CTGAGTCACACGAACATAATCATTGCTCATA


invisible?    
Gene introns: 0  

>13344 174 500     13q12.11    chr13:23180907-23181080 BLAT!
AGCTATGGGCTGACATAAATACTTATAAAAAACATGTAATAGAGGACTATTATCTACAAT
ATACAAAGAAATCTTAAAACTTAAGAAAATGAACAACCCATTAAAAACGGGGCAAAAGAT
ATGAACATATAACTGGCCAAAGATATACAGAGGGCAAATGCACATATGAAAACA


invisible?    
Gene introns: 0  

>13811 163 500     Xq21.1    chrX:81064159-81064321 BLAT!
TTTTTTGAATTGTTTTGAGGATTGTGGCCTCTAGGCACAGTGAAGATGATATTGTATTTT
TAGTGTCTAGGAAATTTGTTGAGTTATTGTTGTTTTAAAAGTTGGTTTCTTCAATGAAAA
CACATGGACACAGGAAGGGGAACATCACACACCAGGGCCTGTT


invisible?    
Gene introns: 0  

>26753 208 500     1p31.2    chr1:69443951-69443744 BLAT!
ATTCTCAACCCATGTGCATCAGAATAACCTAGAATGCCTTAAGACTACCTTTACTTGAGC
TCTGTATCTCCTCACAACTCACCCCTGGAAATCTGATTCCACGGGTCTGGGGTAGAGCCA
GGCACTGTTATTTTTAATAATCTCCATGAGTGATTATGATGCAGACTCACAAATGTGCCA
CCAGGAGTTGGCCAAACCAGTGTGGGTA


invisible?    
Gene introns: 0  

Shown 1501-1530 from 3142 sequences on 51 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs