Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1531-1560 from 3142 sequences on 52 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>17510 168 499     14q12    chr14:26005316-26005483 BLAT!
GGGAGTCTGAGCTGCCCCTCGCCCCTTATTCCGTTCTCTCCCAGCTTTGGCCCAAGGGCA
GGACAAATCAGGGAACTGTGCTTGGGTGCAAGCAACAAAATTTTTGGGGGAATCCTGTCT
TTCTGACCAGAGGACTAGGAATGGGGATTCCTATGAGCCTGAGAGAAT


invisible?    
Gene introns: 0  

>27265 205 499     11q14.1    chr11:81320106-81319902 BLAT!
AGTCACAAGACTAGGTCAATCAATTTTGTCAAGGTGGGAATTTTGTCAAGCTGGGAATTT
AGTGTTAAAGGTGTAGGAATTAGATGGTCAAGCACATGGATTTGAGGTCAGATAGATTTG
GCCACAAATTCTAGCTGCTTCTCTTGTATCTATGGGACACTATCAACCCCCCTTCTTCCT
TCATTCCTCTTCACCTTACCAAGTC


invisible?    
Gene introns: 0  

>7005 202 498     Un_gl0002170    chrUn_gl000217:38360-38561 BLAT!
TAGCTTCCATACATAAGTGAGAACACATAGTTATGTGGTGTTTATATTTCTATGCCAGGC
TTATTTCACCTAACATAATGCCGCCCACTTGCATTCTTGTTGCCACAAATAACAGGATTT
TGTTCTTTATTATGACTAAATAATATTCCATTATATATGTATGTCACATTTCTTTATCCA
TTCATCTGTTGATGGACACTTT


invisible?    
Gene introns: 0  

>8412 115 497     1p13.2    chr1:114609695-114609601 BLAT!
ACCATCCGCGGACTCATGGAATGCCTTATCCACCATCATGGTATTCCACACAGCATTGCC
TCTGACCAAGGCACTCACTTTATGGCTAAAGAAGTACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>20824 163 497     14q21.2    chr14:44082879-44083041 BLAT!
CAGCAGCTTTCAGTGTGCAGTCTCAACAAATCTTACGACTGCTTCCCTTCTATGATTCCC
TAATAGAACCTGAATACACATCACAGGAAAAACAGTTAATAAAGGAGCAAGGAGGTCAAA
AATGAGGATTCTGATGATATATGGGATCAAAATTATATCTCCC


invisible?    
Gene introns: 0  

>22027 179 497     20p12.2    chr20:12064354-12064532 BLAT!
TCAGCCCTTAAAATTACACTTAAAGATCTTAACAATTATTGTTAAAAGAGCCTGCCTTTT
AAAATGAATCATTTGCATGTTTTCAGTTATCCCATTTTGAAAAACCCTAACAATGCATAT
TCATATATTTTTACAAAGTTAAGGCCAGACTGTGTAAACAATTTTGTTTCTATTTTTGT


invisible?    
Gene introns: 0  

>2237 108 496     17q22    chr17:54465741-54465841 BLAT!
CTGCCTGCCTTGGCCTCCCAAAGTGCTAGGATTACAGGCATGAGTCACTGCACCCAGTCA
GCTATTTCTTGATTTATCAATATCTGTGCAATTATAGCTACAAAAGAA


invisible?    
Gene introns: ANKFN1 (54230835 - 54560007)  

>18438 143 496     6q25.3    chr6:160009303-160009161 BLAT!
TTGAATAGACTTGAGTATCTGCTGTTGAAGGATGCAGAGGCTCTGTCAGCCTGGGCCCCT
GAGTGACTTCATGGAGTATACCATCTCTCCAACTGGATTTTATGTAAGTGGAAATAACGT
TCTACAAGGTTAAGCCACTGAGA


invisible?    
Gene introns: 0  

>25459 138 496     6q24.1    chr6:141371699-141371562 BLAT!
GGGACCAAATGCTGGTGGGATGCTAGAAGTTATGAGGTGACTGAGAGCCTGGACGAAACT
GTTGCTGAGGGCTTATAGTGAAGAGAGTGATTAAAAGCTGGAGGAAAGGAAACTCTTGCT
ATGTTATGGGAAGATTAG


invisible?    
Gene introns: 0  

>26734 177 496     Xq11.2    chrX:63884293-63884117 BLAT!
GTCTAGGTGCTTCCTGGAACATCAGGAGGTTGTGTTCATCAGCTAAGTTCCCATAGATGC
AGGACCACTGGGCCAGAAGCCCTAGCAGGTGTTGCCTGCCTGGCCATCAGTGGCCAGATT
TTGTGAGACTTATTTACTATCATGAGAACAGCACAGAAAAGACTTGCCCACATGATT


invisible?    
Gene introns: 0  

>7999 123 495     Xq27.3    chrX:146882713-146882649 BLAT!
GAAGTCCTTCTTCTGAAGAAAACTGAACCCAACCCAAACCTCTGTGAAAGCCAGTCTCCT
TGTCAAAAGGTAAAATGCACCTTCTGACATGGCCGCCCCGCGTACCTGCCCGGGCGGCCG
CTC


invisible?    
Gene introns: 0  

>10585 117 495     7p11.2    chr7:57771949-57772065 BLAT!
GTATTTAAGACATTTGAGGCCGGGCACAGTGGCTTATGTCTGTAATCCCAGCACTTTGAA
AGGCCAAGGCAGGTGGATTCACCTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACA


invisible?    
Gene introns: 0  

>31584 180 495     10q11.21    chr10:43051763-43051584 BLAT!
ATTGCTGATCTTCAGAACAGACTGAGGTTGGAGTGGGATAAGGAAGCGAGGTTCTTGTAA
AAGGAGTGAAGAGACTCCATAAAGAAAGATGATGAAAGTGATGCAAACCTTCCCAGGTCC
CAAGACAACTGGAGACTCCTGCCCATGCTCTAAAGGGAAGGAGCTAGACTCTCCAGGGAA


invisible?    
Gene introns: 0  

>4363 165 494     4p13    chr4:41926276-41926440 BLAT!
TGCTGGACAACCTGATCGTCATTACCTAGGTCTTTGTGAGTATCACCTTCCTTCAGATCT
TTGGCATCTTTCTGGCCTGGAACCTCCTGAGTGACATCAAAGCAGTGAAAGGCAACTGGT
GAGTCTGCCATGGGCCATTGCCACATGTCCAGCTAATTGAGGCCT


invisible?    
Gene introns: 0  

>8329 176 494     14q12    chr14:24638641-24638758 BLAT!
TGATCATGTCACTCCTCTGCTCAGAACCTTCCAGTGGGTCCCAAATCACCCAGGGTAAAA
GCCCAAATCCCCATAAGGACCTCTGAGGTCCTGTGATGCGACCCTACCCTCCTCTCTCGC
TCTCTCGCCCCTTGCCATTCTTCCCCTGTCACTTTGCTCCAGGCTCCTTGAACCCA


invisible?    
Gene introns: 0  

>14003 150 494     2q36.1    chr2:222625134-222624985 BLAT!
AAGAATCTAAAGGTAAAACAAACACACAGAAAATCAAAACCTGCTTTTAATAGATTTTCT
TTTAGGCTAAAATTATTATTAGTGTGTGTTGGGCTCAACAACTTAATCCAGAACTGAGAA
TAAACTGCTTCTCTAGTGTCCCATTCAGAA


invisible?    
Gene introns: 0  

>14069 142 493     4q27    chr4:120903202-120903343 BLAT!
ATTAACATTTAAATTAGTAGATATTAAGTAAAGCATATTAACCTCCATAATGTGGATGGG
CCTCATCCAATCAGGTGAAGGCCTGAAGAGCAAATACATGTTTTCCAAAGAAGAAGAAAT
TTGGCCTGAAGACTGGAACATA


invisible?    
Gene introns: 0  

>20056 209 493     4p15.33    chr4:11432212-11432004 BLAT!
AGCTCTTTAGAAAAAGTAATCATACCAACTTAGAGCATTAAAACCACCCCGTATTTTGAA
GGACTCATGATCTGCACTGTGCTTGGCTGCTGGTGGAAGCTTAAAGACACCAGTAATTGG
CAGAACTTTATCTTAGACTTCCATTTGACCCTCACAACCTCACACATGATTTTACACAGC
TTCCTATAATGGGGGAGAAAAGCCCTTCT


invisible?    
Gene introns: 0  

>28145 142 493     17q21.33    chr17:47566473-47566614 BLAT!
AGGGAGGCCTAGAACAAGAAAGGGACTGTCACAAGGCCACACAGCAAATAAATGATAGAC
TAGCGCCCGTGTCTCCCAATGCCTCTTCCTCCTATCTTCCCATTGTTGACTTCACGCTGT
TCCAGCCATGGTGTAGCCTATT


invisible?    
Gene introns: 0  

>33327 183 493     5p13.3    chr5:32862279-32862461 BLAT!
AGCACTTGTTTTATGAATCTTGATGCTCCAATATTGGGTGCATATATATTTAGGATAGTT
ATGTCTTCTTGTTAAATTGAACCCTATATCATTATGTAATGCCTTTCATTGTCCTTTTTT
ACTGTTGTTGCTTTAACATCTGTTTTATCTGATATAAGAACAGTGACACCTGCTCTTTTT
TGT


invisible?    
Gene introns: 0  

>16325 128 492     6p25.2    chr6:2616426-2616553 BLAT!
CTGCCACCATGCCCAGCTAATTTTTGTATTTTTAGTAGACATGGGGTTTCACCACGTTGG
CCAGGCTGGTCTCGAATTCCTGATCTCAAGTGATCCGCCTGCCTCGGCCTCCCAAAGTGC
TGGGATTA


invisible?    
Gene introns: 0  

>26634 127 492     16p12.3    chr16:21192008-21191882 BLAT!
AAAGAGTAAAGAAAAAAAGCCCACCCAAATAAATATTTAATGAAATGCCACGCAAATAAA
CCACTCAGTAATTCCACTGGGAAATCCCATAGGAAGTTTTATTTTTACTTACTAGTCCTT
TAGCATT


invisible?    
Gene introns: TMEM159 (21169911 - 21191937)  

>29394 142 492     21q21.1    chr21:21908559-21908418 BLAT!
AGTCAATGCTCCTTAGTAAACTCCCGTTCATATATACATCTATTAGCTCTGTCCCTCTAG
AGAACCCTGACTAATACACTTACTGTGTGCTTCCTCATTTTCAGTTAGTCAGATCCTTCT
CATACTTCAAATTATTGACTTC


invisible?    
Gene introns: 0  

>30955 152 491     19q12    chr19:30092094-30092245 BLAT!
ACCACCACCCTCACCAGCCCTCCTCGTCAATACACAACGTCTGGATCAAGGGCATAGCAG
AGCCAGGGGAGCATGTAATCTTGAGCCTCAGGGACTGTTCTGTCCTAGTGAGGACACAGA
TAATGATGGCTACCATCTCTCAAGCTGTATTA


invisible?    
Gene introns: 0  

>11619 176 490     Un_gl0002280    chrUn_gl000228:116085-115907 BLAT!
GTGACGTATCTCTGCACTGATCTCCCAGGTGATGTAACATTTATCTGGGCTCTGCCTTCA
GGGGCGTTTTGACATAGCTCTACACAGATCACCTAGGTTATGTAACTCTTGACCACTCTG
CCTACAGGGGCTTTGTGAAATATCGCTGCACTGATCACCCAGGTGACGGGACTCTT


invisible?    
Gene introns: 0  

>22388 185 490     7q21.11    chr7:86148006-86148190 BLAT!
TAAGGAAGAAAAAAAAGGGGGGACTTCATCTTCTTTCCTTTAGAAACATGGGGAGTGGAG
AATAAATGTTCCTACCTTCAACACTAAACATAAAATACCATCCACTTTCTATTAGTTCTC
TACTAAAAGGATTGCTTAGTTTATATTTTTTCTTTTATTATCTATGTTCATTTCAATATC
TCTTT


invisible?    
Gene introns: 0  

>32692 204 490     13q31.1    chr13:86184293-86184090 BLAT!
AGAAACTGGTTATCTGCAATTTGGTAAACACAATAGCATGAAATCATATTTTACTGGTTT
ATTTAATAATCTTGCAGACAATTTTAAAAAGGCAGATTCTAAGTAAGAAACTTGCATTTC
AAGGTTTTCAGAAGTAGATAACAGTAAGCTGACATTGCGATATTGAAGAACACTTTCTAT
CTTGTCTTCCACTTATATGTTTCC


invisible?    
Gene introns: 0  

>12176 156 489     3q28    chr3:190538291-190538446 BLAT!
ACAACTTGGAAACAATGAACAAATTTTCTGAAAAACACAATTTACCCAATCTGACATTAT
TAGTTTTCTAATTCTGCATTAAAAAATATCCACAAGTGCAGAGGCTTAGAATGAGATTGT
CTAACATGTCTGTAGATCACCAGTCCAGGCATACCG


invisible?    
Gene introns: 0  

>14472 146 489     Xq28    chrX:149399683-149399538 BLAT!
AACCCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAG
CCGGAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGC
TCCTTGGTGGATGAGTTTAAGGAGCT


invisible?    
Gene introns: 0  

>28826 186 489     17p11.2    chr17:21233229-21233044 BLAT!
GTGGCTCACGCCTGTAATCCCAGAACTTTGGGAGGCCAAGGTGGCCAGATTGCTTGAGCT
CAGGAGTTCGAGACCAGCATGGCAAAACCTTGTCTCTACAGAAAACACAAAAATTAACTG
GGCATGGTGGCACACACCTGTAATCCCAGCTATTTGGGAGGCTGATGCAGGAGGATCACT
TGAGCC


invisible?    
Gene introns: 0  

Shown 1531-1560 from 3142 sequences on 52 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs