Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1591-1620 from 3142 sequences on 54 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>30051 132 479     Xp11.4    chrX:38780796-38780927 BLAT!
GCAAGGCATTGAGCTAGATGTGTGTGGGAAACAAATAAATCAAACAGCTTTTTACAGAGT
TGAGAGGTTTGACTGAGATAATACATGTAAAATCTCATCATAACAGGAAAGGCTGCAGTA
TTGCAAGAATTT


invisible?    
Gene introns: 0  

>30435 199 479     11p12    chr11:37279942-37279744 BLAT!
AGCCTCTCTCTGGTATTCTACAATCTTCACCGAATTTCTCTCCATTTTGGTCCATGTCAT
TCTCTGTCACACATAAAAGGCCTTCTCATATCTTGTTTCCTCCTATGGACACTTTCTTAC
TCCCCCTCATTAATTTGGTTTATTTATGCATTCCATGATTATCTCTTACACACATGCTTG
CATGTGCACACAACACAAA


invisible?    
Gene introns: 0  

>32829 149 477     14q24.1    chr14:69492512-69492660 BLAT!
CGCAGGCATTCAGTATACAGCATTCCCCAACATTCTCAGTCTCCTTATTTGCTTTATTTT
TAATTCAATTTTATTTTTAAACAGGGTCTCATCTCGCTCTGTTGCCCAGGCTGGAAACGT
AGTGGTGTGATCTTGGCTCACTGCAACCT


invisible?    
Gene introns: 0  

>8061 168 476     12q14.1    chr12:62009107-62009205 BLAT!
CCTCAGACTATTGAACTGTTGTGCAAATCTGACTACATAAATTTATGGAGTTAATATAAA
ACCCAAAGCTGAGTCACAATCTGGTGAATATATGGGTACCACTGGGGGATGGAAGAACTC
CAAGGAGAGCCCCAGCTGGGTCCTAATACCCCAGGAGCCTTCTGGCTT


invisible?    
Gene introns: 0  

>7351 112 475     17q22    chr17:54465741-54465850 BLAT!
TGCCTTGGCCTCCCAAAGTGCTAGGATTACAGGCATGAGTCACTGCACCCAGTCAGCTAT
TTCTTGATTTATCAATATCTGTGCAATTATAGCTACAAAAGAAAAGCATTTA


invisible?    
Gene introns: ANKFN1 (54230835 - 54560007)  

>12315 164 475     2p24.2    chr2:17014529-17014692 BLAT!
ATAGTGACCAATTATTTCCATTTTTCTGACATTGAGAGGTTTCCCATGATGGAGAGTTTT
TAGTTTGAAAACTGGGAATGTCCCTGAAAAACAAGAAAGAGATGGTCACTTTACTTCTAG
ACATGGTTGTGGACTTGGTAATTTTCCCTGGTCTGACTGGGTCT


invisible?    
Gene introns: 0  

>18604 137 475     7p14.3    chr7:31299125-31298989 BLAT!
TTTTTAGTAGAGACGGGGTTTCTCCATGTTGGTCAGGCTTGTCTTGAACTCCTGACCTCA
GGTGATCCGCCTGCCTAGGCCTCTCAAAGTGCTGGGATTACAGGCGTGAGCCGCCACGCC
CGGCTACGTGCTTATTT


invisible?    
Gene introns: 0  

>25180 178 475     5q31.3    chr5:141437445-141437622 BLAT!
TGGGGAGGTTTGTAAGACATAAATTTGCAGGTTTTTCCTCCAGGGATTCTGATTCAGTAT
GGATTCAGTAGGGTGGGGCCAGAGAATGTATTTTTTTAGTTTTGTTTTTAAAATTAAGGT
AAAATTGCAAACCATGAAATGCAAAAATCTTCAGAGTATAACTGGATGAATTTAAACA


invisible?    
Gene introns: 0  

>2064 112 474     12q13.11    chr12:48235187-48235076 BLAT!
ACAAATTAACTGCTACATTGCCCTGCTTCCTATTGAGTTGGGGGACCTGACAGACGACTG
ATGGTCTTGCTAGCTCTCTCCTAGAGAGGAGATAAAAGAGGTTCCCATTCCT


invisible?    
Gene introns: 0  

>4401 151 474     8q21.13    chr8:82322353-82322203 BLAT!
AAGGGGTCTCTTTTGGAGCTGCAAGCTGTGCTGCATGGGGTTAGGTGAAGTGTGCTGCCA
GCACTACCCTAGCCACCACAACTGGTGTCTCAGTAGATCACGCACCCTCCCAAGTCCCTT
GGCTGTAAGCCCAGTTTAGCACTAGGACTTG


invisible?    
Gene introns: 0  

>23882 115 474     15q21.1    chr15:47365534-47365420 BLAT!
GGTCAGGAGTTCGAGACCAGCCTGGCCAACATGATGAAAACCCCGTCTCTACCAAAAATA
CAAAAGTTAGCCGGGCATGGTGGTGGCGCCTGTAATCCCAGCTACTCGAGAGGCT


invisible?    
Gene introns: 0  

>32955 180 474     8q12.3    chr8:64404027-64403848 BLAT!
TGCACACAGAATATATCCTAAGGTTGACCACATTCTCAATTATAAAGCAAGTCTCAATAA
ATTCAAAACAACTGAAATCACCCAAAGCACATTCTTGGACCACAATGAATAAAAGTAGAA
GTCAATGCCAAGAAGATCTCTCAAAACTACACAAATACTTGGAAATTAAACAACTTGCTT


invisible?    
Gene introns: 0  

>1535 103 473     6p21.31    chr6:34181810-34181901 BLAT!
CAGGAGGATTGCTTGAGGCCAGGAGTTTGAGACCAGCCTGGGCAACACAGCAAGACACCC
CCTTCCCCCATCTCTACAAAAAATTTAAAAATTTGCTGAGTGT


invisible?    
Gene introns: 0  

>21267 186 473     8q21.3    chr8:90602738-90602923 BLAT!
GGGTGTGCTGCTTTAATTGAGACAGTGCCTAAAACAATACAATAACATTTTCTTACAATA
AATGCCCTGACTACCAAATATAATTAGAGAATCTCCAGGTTTCCGCCAAAAAAAAAATCA
ATTTGGAAACATAACACCAGCAAGTCCAGGTATAATAAGAAAATTAACATGGTGGTCACT
GTTACT


invisible?    
Gene introns: 0  

>16011 174 472     10p11.23    chr10:30647653-30647480 BLAT!
GACCCGATCGATTGGCTGGCAGTTGGAGAGAAAGCAGAGAGAAAACGGTAGAGAGAAAAG
TGGGCAGAGAGCTGGTGAGGCAAGCACAGAGCAGGGGCAAGCTGTAGGAGCTGTGGGAGG
GCCGGGGAAGGGAGGGTGCAGGTGTGGGTGTGGCAAGGTTCCTGGAAGAGAGGG


invisible?    
Gene introns: 0  

>26066 133 472     9q21.13    chr9:74723217-74723112 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGATCATGAACCAGGAAAAACTCGCCAAACTGCA
GGCACAAGTGCGCATTGGTGGGAAAGGAACTGCTCGCAGAAAGAAGAAGGTGGTTCATAG
AACAGCCACAGCA


invisible?    
Gene introns: 0  

>3968 180 471     1p21.1    chr1:106996101-106996280 BLAT!
AAAACCTTTCCTTTTATAAACATTTGATTACAGGTGTCTACAGGTTATTATAAGTAATAA
TTTTGCCATGGATTAACGGTGTCCATATTACCATTCTCCGTGGGATCATTAATGTCTTGA
AATATAATTAGATCAAATATCAATTCCAGATAGCCCAGAGCCATTACAGAGAACACTTCC


invisible?    
Gene introns: 0  

>5652 157 471     11p11.2    chr11:44275340-44275184 BLAT!
TCTCAGATAGCTGTTATTGATTTCTAATTTAACTTCACTGCGGTCAGGTAACTTTTTAAT
GTTCAATTCCTCTAAAATTACTGAGACTTATTTTTGTGTAACACATTTGAGGTAAATGTT
GCATGTGCACTTAAGAAGAATGTGTATTCAGCTACGC


invisible?    
Gene introns: 0  

>6458 130 471     2q31.3    chr2:181791132-181791261 BLAT!
GTTCTGTAGTCTTGCTATAATACTGTTGATTTTAGGATATGTTTTATTATAGGGAAGAAT
CATCTATGTGATGGCTAATACTGAGTGTCAACTTGACTGGATTGAAGGATGCAAAGTATT
GATACTGGGT


invisible?    
Gene introns: 0  

>8477 144 471     4p12    chr4:45682734-45682591 BLAT!
TAATTTCTTCCTTCATTGTCTGCCACAGAAATTCTACCATTTCACCTTTAATCAGTAAGG
GCCGGCACTCTTTTCAAGTTTTAGGAGCCAGCCGGGTGCAGTGGATCATGCCTGTAATCC
CAGCACTTTGGGAGGCCAAGGCGG


invisible?    
Gene introns: 0  

>12535 171 471     15q15.1    chr15:42335008-42334838 BLAT!
GCCCCCTTCCTTGCCCAATGAGTGGATGTTTCACCCAAGGCAAAGAGAAGGATCTGGTTG
GTGGGCAGATGGCCAGCTGCTTAGTAGAAGGAAGAAAGGGCTTCCCAGCTCTTGAGAAAA
AATTCCTTCCCTGGGTGGGTTTGCCTGACCCCACCTCAAGCTACACCTCCT


invisible?    
Gene introns: 0  

>21935 143 471     2q32.1    chr2:186851434-186851292 BLAT!
TCATTTAACTAACATATTCTCTCTCTATATGCCCTTATAGGTTGGTGACAGTGGTTTTGG
AAAAAGAAAAAAAACACTTTATGGGTTTTTAGTGTTGTTGAATATCAAGGTATCTACTTA
AACCTTCTAATTTAGGTATAGGA


invisible?    
Gene introns: 0  

>8449 147 470     5p14.1    chr5:28310518-28310372 BLAT!
TTGGAACAATTTAAAAGAAGGAAAGATGATGCAAAAATAAAATTAGAAAAGATTAATTCT
AGAACTTGCAAATCACCTGAGAAAAATAATCTGTGTTGTCAGAAATGAGGAGAGTGATTT
CTCTAGTGGTTACTACTAGAAGAGAGG


invisible?    
Gene introns: 0  

>9198 153 470     Xp22.31    chrX:6444066-6444218 BLAT!
GAGTTCTAGGCTGCAGTGAACTAGGATCACGCTACTGCCCTCCAGCCTGGGGGACAGAGC
AAGATTCCATCTCAAAGAGGAAAGGAAGAAAAAAAGAAAAAAAGAAGGAAAGAAGAAGGA
AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAA


invisible?    
Gene introns: 0  

>12302 192 470     15q15.1    chr15:42335482-42335673 BLAT!
CTCTGACGGTGGGAACTTTACTAGGCAGGGAGGAAGGAACAGGGAAGGGCCAGCCTGGCC
TAGTGAGGGAAATATGTGAGGAAGGTGGGCCTGTGGGCACCCGTAGGTCAGGACCTGTGG
GTGGCCATCCACTCGGCCTTTCTCAGAACCAGCCCTGAAACTCATCTCGTGGGGCAAGTC
TGATGCGAACAT


invisible?    
Gene introns: 0  

>14120 192 470     Yq11.221    chrY:15344274-15344465 BLAT!
GTAGACTTGTGGTTCACCTGATTTGGTATCTTTTGAGTATCATGAATCTTGGTCCATTTC
TTTCCCCAGAATGAGGAGTTTTGAGCCATGATTCCTTCAAATAAACTATCTTTTTTCTTT
CTCCTTCCACGTAAAATTCTCATAATGTGCTATGTTGACTGGCAACGTAAGTGGTGTTCA
TGAGTCAGACAC


invisible?    
Gene introns: 0  

>24873 173 470     15q25.3    chr15:87948458-87948286 BLAT!
CTGTAAAACAGATATGAAAAATGTCAAGAGATTACCCTTATTTATACCCAGGGGGTGAGC
ACTCCAGGCAGAGGTGCCTGCAAGTGACTTGAGGAAGGAGAAAGTGTGGTCAACTCTAGA
AATGACTAGGTAGAACTCTGATACTAACCTTCCAATTACTCCTCTTTAAGAAT


invisible?    
Gene introns: 0  

>11654 174 469     2q31.3    chr2:181602502-181602675 BLAT!
ACCGAGAGCTAAAACCAAATATTATGACAAAAGATACTCCTATCACTGAAGAAGCTGCAA
GGGTTTGGGGAGCTCTCTGTCAGAAACTGAGGATGAAGACCAAATACACATTTCTGATTA
TACTACAATATCATACCTTGTGCTGCAAATGGGAATGGAGCTCATGTGTGTGTC


invisible?    
Gene introns: 0  

>13055 208 469     Xq12    chrX:65771399-65771192 BLAT!
CCATTAGAATGGCAATTATTAAAAACTCAAAAAACAACAGATGCTGTTGAGGCTGTGGAG
AAATAGGAACACTTTTACACTGTTGGTGGAAGTGTAAGTTAGTTCAACCATTGTGGAAGA
CAGTGTGGTGTTTCCTCAAGGATACAGAAGCAGAAATACTACTTGACTCAGCAATCCCAT
TACTCGGTATATACCCAAAGGATTATAA


invisible?    
Gene introns: 0  

>14388 180 469     1q23.1    chr1:157679272-157679093 BLAT!
CATCATCTTCTTTACTCTGTGCGATCTGTTTACATTTCTCAGTTAGTTCTTCTATAGTAG
CTCCTCCTGACTTTTTAGCAACTTTCTCTTCTATAGTAGGTGGAAGTGCAGGCTTTAGGT
TTGGTGGTAAAGGGACACCAGCCTTAGCACACATGGCAGCTGCATTAGCTTTGGCTATTT


invisible?    
Gene introns: 0  

Shown 1591-1620 from 3142 sequences on 54 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs