Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1621-1650 from 3142 sequences on 55 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>22319 139 469     21q21.1    chr21:21527841-21527703 BLAT!
GAGTGAAGAGTTTGTATGATTTCCTCAGTTATAGAGAGTCTTTGTCTGATGGCTTTCTTG
GCTCTGGTTGTAGCAGCAGTGTGCTCAGTGTGTGAACAAGTTCACTTTCTCCTCTAGGGT
TGGAATGGCAGAAGTCTCT


invisible?    
Gene introns: 0  

>22704 144 469     7q21.11    chr7:86148007-86147864 BLAT!
TAAGACAGGTGTGAATGAGAAAAACAGTTCCAGCCTCTTGCAGCTCCTTCTTCTACTGCA
TTCCAGAAAGGGGGAAGTAATATTTTTGGCTGATGAGTTAACAGAAGGAACTGAGATGCT
GAGATCCATAGGCAGATGGATATA


invisible?    
Gene introns: 0  

>31721 176 469     5q22.3    chr5:113270054-113269879 BLAT!
TTCTGAAAAGTAAGAAAGTTAACAAATACTGAATCTATTTCTTTTTCCTAATCTTTCTTC
TGCCATACAAGTGCTAATAAGCAACAAAATAAGCCCCCCAAAGAAGAAGAATTACAATAG
CTTGTTTCCTCCACTGATTACATCCTATAGCCAAGCATTGATTTAGGTCCTTGACT


invisible?    
Gene introns: 0  

>7570 174 468     3q13.11    chr3:103273803-103273976 BLAT!
ACCCAGGAAGCCCCGCTGGCCCCTCCTCTCATAATCATCCAGTAAAAGTGACCACTTCCC
TTACATGACTTTCTTAGGAAAGCATTCCAAGATGAAGAAGGCAGAAGAAGCAAGGCTTCT
TGATGCTAATACTCTGGAAATTGCACAGTATTACTTATGCCAAAGTCTATTATT


invisible?    
Gene introns: 0  

>14488 179 468     12q24.21    chr12:116149045-116148867 BLAT!
AGTGATAACATCTCCACCACATTTCCATAAGACTGAGGTAGCAACCAGACTCTAATTGGG
TAATTGATGGTGCATAATTATTCTTTCTTATCACAAACTTAAGTCTGCTATTTTGGCTTT
CCCAATCCTGAGACAAGGAAGCCAAATTAGACACAAGGTTTGTTCAGAGAATATGGAAG


invisible?    
Gene introns: 0  

>20435 146 468     16q12.1    chr16:51888975-51888830 BLAT!
AGTCTCTGTGTGTCTCAGATTTTTTTAAATCTATGAAACGGACATGATAATGGTATTTGA
TTAAAACAGTAATTCATATAAGAAATTTGGAGCTCAGTGAAGACAGGCCTTCATTAATGA
AATGAGCATGTGGGGCCCTGCTGATC


invisible?    
Gene introns: 0  

>25931 162 468     4q22.1    chr4:91953214-91953376 BLAT!
CTAGAACAGTATTTGTTAAAGAACAATTGTCTAGAAAGGAAAAAAAAATGTGATTTTTTG
CATAACTCTGCATATTGTTTTAATAATATACTTCCATTAGTTCTCTTGCCTTTATATTAC
TTACATGTTATACATTTCTTCAAATAATTTTACTGTGGGGGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>18235 130 467     Xq21.32    chrX:93295107-93294978 BLAT!
ACCTTGTGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGAATTACAGGCATGAGTCACCG
TGCCTGGTCCTAAAAAGAATTTTAATAGTAACTTTATTTGTAATAGCAAGAAACAAAATT
ACTCAAATAT


invisible?    
Gene introns: 0  

>2176 102 466     Yq11.21    chrY:13842692-13842755 BLAT!
GGAATGGAATGGAATCAACCCGAGTGCAATGGAATGGAGTGGAATGGAATGGAATGGAAT
GGAACAATCCGAATGGAATGGAATGTAATGGAGAGTAAGGGA


invisible?    
Gene introns: 0  

>4839 186 466     18q11.2    chr18:20160223-20160038 BLAT!
ATGTTAAATTTACCATTCAGAATTTTATAGCTTAAATACGGAACAAAATATCTTCCAATC
ATGTCTTCTCTTGAACTCCATAAGCTGTAGTAATCAACATTGAAAATGATTAGTCTAGGA
ATCACTTTCAGTGTTGATTACAGCCTTGCCTTCCATACCCTGTCAGCAGGGAGGAGGGTT
CCATGG


invisible?    
Gene introns: 0  

>12458 144 466     17p12    chr17:14997497-14997640 BLAT!
TGAAAGCAGACCCAAGAAATGGGGAGGGAGGCAGAGAGGGAACATGATGATATGGTTTAT
TTAAGTCCCAAATCTATCCATGACTGAAACCAAACTAACTCACACAGTTTTCAATTATGT
GAGCCAATCAATTCCTTTTGGCTT


invisible?    
Gene introns: 0  

>31130 117 466     22q12.1    chr22:28579723-28579607 BLAT!
AAAACTAGTATCATTATAATTTCAGGAGTCTAATAAAGCTGGTCTTGGATGGCTGCCAAA
CGAATGTGTCAAAGAACAGGAAAAAGGCAATGATAATGCTGAGCTTTTGACTGGAAG


invisible?    
Gene introns: TTC28 (28374001 - 29075853)  

>18392 182 465     13q31.1    chr13:81251721-81251540 BLAT!
AATCATATCACTAGAGAAAATCACCTTCACTAGAGGAAGACAAGAAGGAAAGAAACAAGG
AAGAGAAGATCGCAAAACAACCACAAAACAACAAAATGGCAAAAGTAAGTCCTTATCAAT
AATATCATTGAATGTAAATGGACTAAACTCTGTAATCAAAATACATATACTGGCTGACTG
AA


invisible?    
Gene introns: 0  

>33216 151 465     1q32.2    chr1:208516406-208516556 BLAT!
AGAAACTTTGGTTCCAGTGGAAGCACACACGTGTGCCCCAATCCACAACCGCCCCCCTAC
ACAACGTGCATGTGCTAGCAAACATAGAGCAGAATTGTAATGCAGTAGGAGTTCAAAGAG
GAGACAATGCTGGTTTTGTTTTGCCAGAGCC


invisible?    
Gene introns: 0  

>8824 188 464     2p22.1    chr2:40837299-40837486 BLAT!
CTCTGGGACTGTGATGGGAGGGACTGCTTGGAAGATCTCTGAAATGCTTTCAAGGCCTTT
TGCCATTGTCTTAACTATTAGCACTTGGTTCCCTTTTAATCATGTGAATCTCTCTAGCAA
GTGATTACTCCATGGGCTGCTTGAATTCCTCTCCTGAAAACACTTTTTCTTTTCCTACCA
CATAACCA


invisible?    
Gene introns: 0  

>12720 111 464     19q13.43    chr19:58995569-58995459 BLAT!
AGCCTCTCAAAGTGCTGGGATTACAGGAGTGAACCACTGTGCCCAGCCATTGCCAACACT
CTAGTATTAGCTTGGTGAGATGGTGTCTAACTTCCGGTCTCCAGAATTGTA


invisible?    
Gene introns: 0  

>27892 175 463     16q12.2    chr16:53598623-53598449 BLAT!
GTAAAAGGAAAAATTATTAATGCCAGTCCTCTCTTTATTTAACATTTTGATGGTTTATCA
CGGGTTGTTTTGGCATTTTTTAAAAAAATATTGCATGAAAATAGGATCATCTTGCTGCAT
GAGTTTTTTGGCACAACCCAAAACGTTGTGCCTGAGGCAAGTGCCTCGTTTCCTC


invisible?    
Gene introns: 0  

>28 110 462     20p12.3    chr20:6195201-6195102 BLAT!
AAGCCTCTGTTTTTTTTCTTGTCATCCGGTTGGTGGTATAAAATGACGTCTGTAAGACCC
TCTGTTACTTTGCTAAATTCTTCAAGAATCTGTTCCTTGGTTTTACTCTT


invisible?    
Gene introns: 0  

>7347 133 462     1p34.1    chr1:46039940-46039808 BLAT!
TGGCGTAAATGAAGTCTAGGGAATTCACGGCTACTTACAGCAGGGGAGATAAGGCGTATG
TGAGTAGAGTGAATAATTCCCTCCCCCAGCCCCGCTAGTTAACATGGGTAAAAGCCTCTT
TAACACCCATGGG


invisible?    
Gene introns: 0  

>20416 164 462     2q32.1    chr2:186886986-186887149 BLAT!
TTGGTTTGCTAGTATTTTGTTAAGGATTTTTGTATCTATATTTATCACGAAGATTGGCCT
ACAGTTTTCTTTTTTTGTAATGTCCTTGTCTGGCTTTGGTATCAGGGTAATGCTGGCTTC
ATTAAAAAAGGTTGCAAGCATTCCTCCTCTTTGATATGTCAGAA


invisible?    
Gene introns: 0  

>31650 174 462     7p11.2    chr7:57866879-57867052 BLAT!
CTTGGAGATATTGCAGGTTTGGTTCTAGGTAACCACAATAAGGTGAATATCACAACAGCG
CAAGTCACACGAAATTTTCTGCAAGTCACACAAAATTTTTTGCTTTCTGGTGCATATAAA
AGTTATGTTGCCAGGCATGGTGGCTCATGCCTGTAATCCCAGCACATTGGGAGG


invisible?    
Gene introns: 0  

>11942 140 461     5q32    chr5:148868793-148868654 BLAT!
GGCCGAGGCGGACGGATCACCTGAGGTCGGGAGTTTGAAACCAGCCTGACCAAACATGGA
GAAACCCTGTCTCTACTAAAATTACAAAATTAGCTGGGCGTGGGGGCGCATGACTAATTC
CAGCTACTCAAGAGGCTGAG


invisible?    
Gene introns: 0  

>12398 169 461     1q32.1    chr1:199466347-199466515 BLAT!
CAAAAAGTAGGAAGATAACACATTAACAATGTAACGTCACACCTCAAGGAACTAGGAAAA
CAAGAACAAACAAAACCCAAAGTTAGCAGAAGAAAAGAAATAACAAAGATTAGAGCAGAA
CTAAATGAGAGATCAAAAAACAACATGAAGGATCAACAAAATGAGAAGA


invisible?    
Gene introns: 0  

>15295 177 461     21q22.12    chr21:36514717-36514541 BLAT!
TCCCTGACACCATCACAGATCCTTCAAACTGTATGAGACATTGGGAATCATCTATTCCAA
ATTCCTAATAAGAACCCAGAGGGACACACCCAAAGTCACACAGTTATTGAATGGCAAAGC
CAGACCTAGGATCCAGGCACCTCAGCCCCTGATCCAACACTACTCTCCTAGCCCCTG


invisible?    
Gene introns: 0  

>20773 113 461     11q12.1    chr11:56503838-56503928 BLAT!
TCTCCATTAAACCCATTAACATGCAGGATCCTCATCTGCTTCACAATGGTGCTTTTACCA
GATTCTCCAGCACCCAGCAGCAGCAGGCGGTGCGTGGCCCGGTAGACCTGCTT


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>25564 111 461     2q34    chr2:210137256-210137146 BLAT!
TGAGACCATCCTGGCCAACATGGTGAAACCCTGTCTCTAGTAAAATACAAAAAAATTAGC
CAGGTGTGGTGGTGTGGTAGCACATGCTTGTAGTTGCAGCTACTCAGGAAG


invisible?    
Gene introns: 0  

>3799 156 460     11q22.3    chr11:107607113-107607253 BLAT!
GTCTGTGATGTAAGGAATGATTCCCACGTAGCAAGGCACTGTTCATAATAATGGATATTC
TCCTCAGCCATATCTGTAAATGCTAACTTGATATCATTTTGCATATTTTGTTTCCATCTC
TCCCAATCTGCTTTCAGGGCATTATTAGCACATTCC


invisible?    
Gene introns: 0  

>11726 151 459     21q21.3    chr21:30112202-30112352 BLAT!
AACATAAGTAGAAATGGGAAATTTTTCCCGAAAGACCTCTATGGAGCATGAGAAGAAAGG
TCTACTTTGTATCATCTGGAGGATTTTTTCCTCTTTCCATCAAGTTTCAGCCAATAATTA
AAACAAGTTAGCAATATTTTTCATCCCAACA


invisible?    
Gene introns: 0  

>21435 178 459     18q21.33    chr18:60708593-60708770 BLAT!
CATCAGCAAATCACAAGCCCAAAGATGTTATGTGAAACGTATATGCATCACCTCTCCCTT
CTGACACTTCTGATAAAATAATAGTAAGGAAGTAAAAAGGAATAAATCCCTAAGGACAAA
GAATATAGAAGAAAACATCAGTAGAGAAGAGAGTTCAATGAAATTTTTCAGGACAAAA


invisible?    
Gene introns: 0  

>6824 182 458     3q25.32    chr3:157252394-157252213 BLAT!
GAACAGGGATTTGCAAATAAAATTGGACTATTTAATTAGTCTGACTACTATTTAATTTAA
TTGGACTATTCACATTTTTATCCATCTCTGTTATGAATAGTGATTTTATTGACTGAACCA
GCTTTGGAATTACATAGTTTGGGAGGGAGATAATAAATGAGTAAGCAACTAAATTAACAA
AA


invisible?    
Gene introns: 0  

Shown 1621-1650 from 3142 sequences on 55 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs