Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1681-1710 from 3142 sequences on 57 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>8125 199 449     7p21.3    chr7:12027567-12027765 BLAT!
CAGTTTCTGTAACTATAAAAAGTAAATTCATTTTACTTATAAATTACCCAGTTTCAGGTA
TTTTGTTAAAGTAACAGAAAATAATACAACCATCCCATTAGTGAATTATATTTTCTTAAA
TATAATACCTAGAAGGCTACAAAATAAAATAAACTCAAGTATTTAAAATTAATTTTAAAA
CTTCCAGAAGAGATATTGT


invisible?    
Gene introns: 0  

>20480 126 449     2q14.3    chr2:125686195-125686075 BLAT!
TTTACAAATATACTTCCACATTGTTCATTTTATTACTCGTAATAACTCAGTGAGTGGAAT
ATTTTATATACATACTACAAATTAGACACCCAAAGCTCAAGATAGTGATTCATCTATCAC
TAGGAA


invisible?    
Gene introns: 0  

>5044 158 448     10q22.3    chr10:79505835-79505678 BLAT!
CTGCTGGCAGAGGACAGTTACTAGACTCTGATTCCTGGAAGAAGAGAGGATTTTAGGTCA
GGATAAGTTGCCTATGTGGTTTTAGGCTCTTGGGATATTGTCTAAGTGTATGTCAAATTA
AGTTACTATCTTTTGAAATTCAAGAACCTAAGGAAAAA


invisible?    
Gene introns: 0  

>3177 166 447     5p15.2    chr5:13848274-13848439 BLAT!
GACTTGATCTAATAATTTTATAAGGGAGATCAACTCATTAATCCCTAAGACTCCATTTTT
CTAAATCTTTATGTTAGAAGAATTACTTGCAAATGGTTTTGCTTTAAAGTAAACAAAGGG
TGCTTTACTGACGTTGGCGTTGGCTATGGCCATGGTGTTTAAAAAG


invisible?    
Gene introns: DNAH5 (13690436 - 13944589)  

>24582 228 447     6p21.1    chr6:42577336-42577563 BLAT!
GTGTTGGCCAAGCACATCGGCTCACTCCTGTAATCCCAGCATTTTGGGAGGCCAAGGCAG
GCAGATTGCTTAAACCCAAGAGTTTGAGACCAGCCTAAGCAACATGGCAAAATCCCATTC
CTACAAAAAAAAAAAATAATAACAAAAATTAGCCAGGCGTGGTGGCACACACCTGCAGTC
CCAACTATTTGGGAAGCTAAGGTAAGAGGATTGCTTGAGCCCGGGAGG


invisible?    
Gene introns: UBR2 (42531759 - 42661243)  

>27270 134 447     10p15.1    chr10:4244820-4244953 BLAT!
GCGAGGATGGGAGCCAACGTGGAATCCTCATTGAAAAAAGGGCTGAGAAGGCCCTAAGGA
ACGTTGTCAAGGAGAGAGACTTTGTCATGCCAAAGCTTAGGATGGCAACTTTATGAAACA
TAAGCTTGAGATCC


invisible?    
Gene introns: 0  

>30748 179 447     7q21.11    chr7:85722027-85721849 BLAT!
AATTTCATGAGCATGAGCCCACTGCCACACTTCTTTAGCCATGAAGTGAGTGCTTTGGTC
AGAGGCAATGCTGTGTGGAATACCATGACAGTGGATAAGGCATTCCATGAGTCCATGGAT
GGTAATCTTGGCAAAAACATTATATTCAGGAAAGGCAAACCCATATCAGAAGTAAGTGT


invisible?    
Gene introns: 0  

>6001 141 446     5p12    chr5:44475610-44475470 BLAT!
TTGTAAAGCTGTTGCTTTTTTGACATTTGTAGATACTTGCTTAATTTGTCTGTGAGTTTA
TGTCTTTTTATTTGAGCCGTTAAATTCTGAGGCCTAGACAAGTGGCCATGGTGAGGCCTT
GGGCAGTGCCTGAGCTCCATT


invisible?    
Gene introns: 0  

>19978 134 446     6q15    chr6:92645725-92645858 BLAT!
AATACTAGAATAATTTTTATATTATGAAAATTGAAATCACATGATAATTGTCAATCATGG
TCACATATACAAGTGGAATGGGGGAGAAGAAAGCTCAGATGGTTTACTAAAGGAAGGAAG
TAGGCATATAGCCA


invisible?    
Gene introns: 0  

>26103 177 446     1p31.3    chr1:68096174-68096350 BLAT!
TGTCCCCTTATTTCTCCGAAAGCCAGGGGTTTGTAGAAGAGCATTCCTGGGTGTGTTTCC
TGATGGGGAGAGCTAAGGGCAGAGAATCTAGGATAACACTTGGCCTTCATCCATTCCATG
ACACGTCACACCTTTGGCATCTATTTGGCTGTTGGTAGGAAGGGGGAAAGGTGAGAT


invisible?    
Gene introns: 0  

>14016 127 445     18q22.2    chr18:67026129-67026003 BLAT!
TAAGTAGATGAACTGTGACTTGAATCCATGTAATCCTACTCTAGAGACTGAATTCTTAAC
AACTATGTTCTATGGCCCTGGTGGAAAGTTTGCTTTGTGATAATGTTGCCAAAAACAAAC
AAAAAGG


invisible?    
Gene introns: 0  

>23047 137 445     13q31.2    chr13:87871480-87871616 BLAT!
GTGTCGACCCTGCACCTGGTCCTGCATCTGAGGGGTGGCTGTTAATTCTTCAGCCTTGCA
TTCGCAGTGCCCAGGGACAGCATTACTCTGCACTATAGCCATTTGCCCCAATTTAAGTTT
AGAAATCACCAGTTACA


invisible?    
Gene introns: 0  

>25194 128 445     3p12.3    chr3:74218069-74218196 BLAT!
CAATAATAAGGCAATCTGCTGAAATAACTAGTTTCTTATAAACTCTAAAGTCATTTAGGG
CAAAGCCCTATTTGATGATGTTGGTTAGGGTAGCACAATCTGTCACAACAAATTAACTCC
TGCATTTC


invisible?    
Gene introns: 0  

>26562 136 445     2p22.3    chr2:34540060-34539953 BLAT!
AGCGTGGTCGCGGCCGAGGTACACGGGGGATATCCTAAAACATACAAATATAAAATAAAC
ATAAGTGACAGTTCTATGAGCCTTCAGCCTAAGGATCTTACAGCAAACACCTGTGAAACT
CGACCCTTTAACGCCT


invisible?    
Gene introns: 0  

>27820 167 445     3q25.31    chr3:156464004-156464170 BLAT!
GCTCAGTGAGACCTCGAAAGTTGGTGCTTTGTGGTGTTGCCAAAATGCCTGTTTCTGGCA
AGCAGTGGGGGTAGGTGCTGCTTGAGGGAATCTTGTTGCCCCTCCGAGTGAAACAACACA
TTCATTATTTAATAGTTATTCAGCATCGGAGAAATTTTAGCTCAAGA


invisible?    
Gene introns: 0  

>29509 128 445     18q11.1    chr18:18700278-18700151 BLAT!
TTTATATTCATACAAATCAATAAGAAAAATTCTGAGTCAATTGATGAATAGGCACAGAAT
GTAAATTAATGCAAAAAAAACAAAAACAACTAATTGACAAACATATGGAACACATATCCA
ACCTCATA


invisible?    
Gene introns: 0  

>32499 128 445     16q24.1    chr16:84993831-84993704 BLAT!
CATTTTCTTCTCCGCAGGACTTCTCAGAGCCTTTGCTCTACGACGGGCATTACCATACTC
CACAAAGCAGATGGAGAATGTGGTATTTTGCACCCACGTTCGGCCACTGTATTCGTTTCC
CATGGCTG


invisible?    
Gene introns: 0  

>32509 169 445     5q13.2    chr5:70872574-70872406 BLAT!
TATAAAGAAGAAGCATTAAAAGCTTGCCACCAATGCCAGCAAAGTTTGTGCCACGATTTC
TGATTTTCTTCTTTTCCATCTAATTGGCCTTTAGGTCCCCAATCCACAATGTCTCCAGTT
AACATAGATTGTTTTCTAGCCAGTGGGCCAAGACACTGGGTCTATGGAG


invisible?    
Gene introns: 0  

>3084 112 444     3q13.31    chr3:117199811-117199716 BLAT!
AGCGTGGTCGCGGCCGAGGTACAGTAAAAAGTAAGAAAGGAACAGCTATATTAGAGAGAT
ACCTGCAGAGCTGTCAATCTACAAGTGTTTGGCAGTGGGAAATTTTCTTGGC


invisible?    
Gene introns: 0  

>18614 151 444     9q31.2    chr9:109520681-109520531 BLAT!
TTGAAAAAATTATTTCACAACTCTAAACTGGAGTGTGCCCATTTGAAAATTGGGAATGGT
AATATCTGACTGATAGTATTTCTGTAAAGATCAAAGAAAGTAATGTGTGTGGTATATGCT
AGATCTGATACCTAGCACACAGCAGTGATTA


invisible?    
Gene introns: 0  

>19495 139 444     9q33.1    chr9:120791411-120791273 BLAT!
TGTAGAGGTTTAAATACCTCAAAAACTTTAGAAAACTGTAATTACCACTTTTCCTGCTCA
TACCACCCTGCCTCCACTCTCTCTAACAGCATATAAAAGGGAAAAAAAATTAAGGCTGAT
GTTACCTGGGAAAAAAAGC


invisible?    
Gene introns: 0  

>12667 151 443     1p36.31    chr1:5518357-5518507 BLAT!
CCGCAAGCAGGATTGAATCTGCCGGCCACTGTTGTTCCCCTCCCTTCCTCCTTCTCTCCC
TCCTTCCTTCCCTCTTTCCTCTCTCCTTCCTCCCTTCCCTCCTTCCCTCCCTCCTTCTTT
CTTTCCTTCCTTTCTTCCTGTTCTTCCTTCC


invisible?    
Gene introns: 0  

>21694 162 443     21q21.1    chr21:20571038-20571199 BLAT!
TCATTTCCATTACGATTTCTTCTAACACTTTTCAATACTGATATTTGAGGCTGCCATAGA
ATTTACCAGGCAAACATACCTTCTCCGCTATCAATATCCTGAGTTGGATAATTGCATCCA
ATAAATATGCTCCACTCGATATCCAATATAGGACTGCAGTTG


invisible?    
Gene introns: 0  

>23930 177 443     4p12    chr4:44854268-44854444 BLAT!
CAAGTGCACAGAAGTCAAGAATTGGGGTTTGTTAACCTTCATCTAGACTTCAGAAGATGT
ATGGAAGTGCCTGGATGCCCAGGCTGAAGTTTGCTGCAGGGGTGGGTGCTCATGGAGAAC
CTCTGCTAGGGTAGTGCAGAACGGAAATGTGGAGTCAGAGCTTCCACACAGAGTCCC


invisible?    
Gene introns: 0  

>27779 142 442     5q15    chr5:92447236-92447377 BLAT!
TATAAAACATTCATATAGAAATTAAAACAAGTCAGAGCAAAGAGCAATTTTGTAGCTTCT
CTTGTGTCAAGCACTTCAAAAATTGCATTTGCACTTTAATTCTACCTCAGTTGCATTTAG
AAATTATGAAATCAGCTTCCAG


invisible?    
Gene introns: 0  

>31633 151 441     3q26.1    chr3:161472527-161472677 BLAT!
ATGTAAAGTAAAAAGAATTGAAAAATATGTCCAAGCCGGTAATGAGGTATTTTTAAAATT
TGCATACAGCCATAGCTGAGTCTTATACCTATGTGTGATATATACTGAAGGGGGAATAAA
TACTGAGAAATCCTGCTTTGAGTTCTCAGCC


invisible?    
Gene introns: 0  

>6761 154 440     4p15.1    chr4:29392405-29392558 BLAT!
CGCAATTTGCCTAATTCATTACAGCAGCATTATTTAAATTTGTGTTGACAAACTTGTGGA
TTTTGGTAGCTAGATGGATATTTGCATAGAGAATAAGGAATCCTCCTACGATGTAATTCA
CCCTAAGACTGAAATACCAAACTTAGATTGTTAG


invisible?    
Gene introns: 0  

>13035 153 440     17q22    chr17:52800150-52799998 BLAT!
TCTGCCTGCCTTGGCCTCCCAAAGTGCTGGAATTACAGGCATGAGCCACCACACTTGGCC
TTAGAACTGTGCGACTCTCTCAGTCATGGTCTACTTGTTTGCAAAATGACCACCTTGGGC
AAGATCAGTGTTTTCCAACCTGCAGTAATTTGT


invisible?    
Gene introns: 0  

>11498 185 439     5p14.3    chr5:22952030-22951846 BLAT!
GCTTTCATTGGTAGCTAAGAATGAGTATGTATATCTGAGGGTAAAACTTATGAAATATCA
AGGACTCAAAGAAAAGAAGACAATTTTAATAATAAAACCTCAAAGCTAAGCTTCATGAGC
TTCATGCAAATCCACATCTGCTGGACATTAGATATGGTAAATTAAGTCATTCCTATTCTA
AAACT


invisible?    
Gene introns: 0  

>15404 153 439     20p12.3    chr20:6878476-6878628 BLAT!
AAACCACCTCAAAACTCAGTGACTTAAAATGACTAGTATTTATTCTTGTTCATGTGACTA
CACAAGAGGCAGCTAGTCAGCTGGGAACCTAGGCTTCAAGTTGCCGATCTAGCTGGCCTG
GGTTCTAGGCTGGCAGCTGGGCTCAGGTCTACT


invisible?    
Gene introns: 0  

Shown 1681-1710 from 3142 sequences on 57 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs