Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1711-1740 from 3142 sequences on 58 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>9699 184 438     6q14.2    chr6:84682345-84682528 BLAT!
ACGTTAGTCATCTTGACCATAATATATAGTTTCTATAAACATTTTTATAGCCTGTTTTTT
ATTAAAAAGTTAGTTAATGCTCCAAGAAAACCCTGTTAATCTGACACAGGTGCCCACATG
CTGATCTTTCATCAGTGTGCCTTTGATATTAATGTTTAATTCATAGAGAAACTCTGAACT
AATG


invisible?    
Gene introns: 0  

>17558 186 438     1p34.3    chr1:39172134-39172319 BLAT!
AATGACAGATTTGACACTGCAGAAGAAAAAGACCAATGACCCTGAACACCCTAGCAATAT
AAACTATCCAAAATGAAGCACTAAAAGAAAAGAGATTGGGAAAAAAAATCCATTGGTGAC
CTTTAGAACAATATCAAGCAGTCTAATATATGTGTAATTGGAGTCCCGAGGTGGGAAAAA
AGGAGG


invisible?    
Gene introns: 0  

>28799 179 438     7p13    chr7:43393467-43393645 BLAT!
AAACTCTGAGATATAGCTCAGCCAAAGGAGACACTAAATCAGAGTGAGTGTTCAGCAGCA
CCATGCCGTGGAAAGCTTGTTCCATAGATCCCCTTGGCATGAGCCCTTAGCCAGTTTTTC
CATAGTCCTGGGATAACCCTTTTGGGACCTCCTCCATTCAGGATGGGCAGCAATCTGAT


invisible?    
Gene introns: HECW1 (43152197 - 43602938)  

>804 127 437     1q41    chr1:217404881-217404755 BLAT!
CACTTTGGGAGGCTGAGGTGGGCAGATCACCTGAGGTCAGAAGTTTGAGACCTGCCTGGC
CAACATGGCGAAACCCTGTCTCTACTAATAATACAAAAAAATTAGCCGGGCGTGGTGGTT
GGTGCCT


invisible?    
Gene introns: 0  

>4278 132 437     14q31.1    chr14:83514933-83514802 BLAT!
CTATAACACTCAAAATTTCTTTCAAATTTTCATTGACCTGTAAAAGCAAATGAATGTATG
CTTTTTTTCTACTATCACATGCATCTTTGTTTTAATAGAACAATTTTCAAATACTTTTCA
ATAATTTTTTCA


invisible?    
Gene introns: 0  

>5913 132 437     1q41    chr1:217404880-217404749 BLAT!
ACTTTGGGAGGCTGAGGTGGGCAGATCACCTGAGGTCAGAAGTTTGAGACCTGCCTGGCC
AACATGGCGAAACCCTGTCTCTACTAATAATACAAAAAAATTAGCCGGGCGTGGTGGTTG
GTGCCTGTAATC


invisible?    
Gene introns: 0  

>12188 175 437     4q31.3    chr4:155319882-155320056 BLAT!
ACTGCCGGCCCTAACCAATAAAGTCACATTTACTATATAAAGAGACTTAAGTCTCCATTC
CTATTTAGAACTAAGATCTGAGTCTAAATCTGCATAAGCAAAAACTCACTAAGTTATTCT
ACTAAATAGAGGATTACAGGTCTATATCCCTCCAGCCAAAACATTGGCAGAGACT


invisible?    
Gene introns: DCHS2 (155243805 - 155412877)  

>18677 124 437     1p36.13    chr1:19661654-19661531 BLAT!
ACTGCGCCCAGACTGAAGCCTTTCCTGAGGTTCTCCTGGGGCCCCAGGTTCAAGACTCCT
AGTCTCCCAAGATTTTCTCCTGCATTCAGATTACTTTCTGGGTAACTGCTTTGTGGCAGG
CCCT


invisible?    
Gene introns: 0  

>27380 194 437     7p14.2    chr7:35252886-35253079 BLAT!
ACTTCTAAAAATTCCAAAGCTGACACCACACTCCCATACCAATTAAATCACAATCTTTGG
GAGTGGGAGACAGGCTTCAGTAATTGTTAACATTCCCCCCTGGTGATTCCAATGAGCAGG
CAAGTTTAGAAATGGAAGATAGGTGTGTGGATGGATACTTTTCACCATATACTCCTGTAT
AACTTTTGAATTTT


invisible?    
Gene introns: TBX20 (35242041 - 35293711)  

>5396 172 436     12q24.33    chr12:130468233-130468403 BLAT!
CCCGACCCACTGAGCAATATTTTTTTGCAAAGGAAGATTTTTCTTCTTACTGTGGTCATT
TTGCTCAGTGGAGTGGTTCTGCTTTTGTAGTGCAGAACAGTTCTCCACTGCCAAATCCGG
TCCCTGTAAACTCCTCCTAGCTCAGCCAATTTAAGAAATTAAGTGACGGAAA


invisible?    
Gene introns: 0  

>6304 144 436     2q31.1    chr2:172348274-172348417 BLAT!
ATCCTGGTTTCCAACTATAACCCAAAGGAATTTGAAAGTCGTATTCAGTATTGTTTGGAA
AACAATTGGCTTTAACATGAGAAAGCTCATACAGAAGAGAAAAAAGAGCTGCTGTTCTTA
AGTAACGCAAACCCCTCGCTGCTG


invisible?    
Gene introns: 0  

>10317 154 436     2q14.1    chr2:118002290-118002137 BLAT!
AAGAAATAAAGGCACAAGGGGATGGAAATCAACAGTGAAAATTCGATAAGGTTAATGGAT
TGGAAGTCCCAGTGGTTGGGTGAAAGTTAGAGTTCAAAAATAAGTAGGTCTGGGATGGAA
AAATGGGAGACGTTAATAGGAGAATGGCTGCTTG


invisible?    
Gene introns: 0  

>29180 118 436     9p24.3    chr9:1972428-1972311 BLAT!
TTAGGCAGTGCCTCAGTGGAAACTCTGTGTGGGGACTCTGACTCCACATTTCCCTTTTGC
ACTGCCCTAACAGAGGTTCTCCATGAAGACCCCACTTCTGTAGCAAACTTCTGCCTGG


invisible?    
Gene introns: 0  

>4684 109 435     4q32.1    chr4:156487542-156487622 BLAT!
CTGAAAGGCAAATCTCACTGGTGGTTCTTTTATGCGCATGACAAGAGCAGTCAATTTTTT
CTTCTAAGTTTCATGCCCCTGCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>11596 195 435     2q12.1    chr2:104917964-104918158 BLAT!
TCAGTCTGCAATGCCTCCCCATCGTCTCTGCCCACACATCCTTTAAGCCCTAGCTCAAGT
GCCACTTCTATCTGAAAGCCACTCCATGATCATCCCTGTCGGAGACCATCTAGGCCTCCT
TGAAAATTGTATTGCTCTTTGTTACTGTCCTATGGGACTTATGGACTATGTGACAAGAAT
GTCACATTTTTGTTC


invisible?    
Gene introns: 0  

>18928 166 435     15q26.3    chr15:99980653-99980818 BLAT!
GCAGGCCCACAACGAACATGGTGGGGAGGCATCTGTTCCAGGCAGGTGGCATTTTACCTT
GGGGCTTCACACTCCCCAGTGGGTGAGTTAGTGGTTTAGATGCCACTAGTGGTGGTCACA
CTGATAGGTCATGGAGACTGACGCCAACCTGGGTTCCAGCAAGGGG


invisible?    
Gene introns: 0  

>1682 112 434     15q14    chr15:36660251-36660140 BLAT!
AAACAAAACAAAATAAAAACCCAGAAGCTAATTTCCTTCAAAAAGCATTGATATTTAGCG
AACATAATGCTGGCTTTGTCTAGCTAAGTTGCCAATATTTGGAAACAAAAGT


invisible?    
Gene introns: 0  

>3851 138 434     4q25    chr4:108274527-108274390 BLAT!
GTGCTTTTTACCTACCAGTTCTCAAGGGGAACTAATAGAGGGAGAACTCATTCACCCTGA
GAAAGAACATTAATATATTCATGGGGGATCCACCCCCAGAACCCAAACACCTCCCAGCAG
GCCTTCCCTCTCAACATT


invisible?    
Gene introns: 0  

>5306 210 434     4q34.1    chr4:176050507-176050716 BLAT!
TTCACCATGTTGGCCAGGATGGTCTTGATCTCCTGACCTGGTGATCCGCCCACCCTGGAC
TCCCAAAATGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCCCATAGACATATTTTAT
TTTCCTCAAATATATTACTACATATTAAAGTATACTCATAAGATAAATCTCTTATCTTTT
TGCCTGCATATTCCCATCCATCTTTCACTC


invisible?    
Gene introns: 0  

>12223 138 434     1p21.2    chr1:101727251-101727114 BLAT!
TAGGCAACTGTGGCAGGGGGAAATGGTATTTCTTCCAAAGAGTATAAAGCAGAATACTTG
GGGAAAGGACCAGAAGCAGATTTGCCTGGACATCTCACTTTTCTGCTTGGTGGATCTTGA
GAGTGAATAGTCTCAGCC


invisible?    
Gene introns: 0  

>17569 152 434     Xq11.2    chrX:63390139-63389988 BLAT!
TAAAGTCTGTATTCTTTAACCTGTGTGGCCACTGAAGTTTCTGTTTGGTTAGCTGAGTGG
TTGACTAATAACTGGACAGAGATATTCTTAAATGCTTGGAACCAGTAAGCTTCTTAGCTC
TTGCCAAGTAGCTCAGTGTATATGTTGGAACA


invisible?    
Gene introns: 0  

>28712 183 434     7q31.1    chr7:113433224-113433042 BLAT!
TTCAGTCTCCTTGGCTTTGTAATCACGACTTGATAATCTGGCCCCTGTCTACATCTTCAG
CTTTATTTTCTCCCACATTCTACACATATCCTGTGGTGCAGGATAACTGTTTACATGTAT
TTTAAATACTGCACTCTCTCTTGAGCATTCTTTTTGCATATGCTCTGTCTCCTTTCTTCA
TTG


invisible?    
Gene introns: 0  

>31099 221 434     15q25.3    chr15:87698568-87698788 BLAT!
TTAGCCAGTTTACTCATCAACAAATATATCTTTGATATCTACTATGTAAATATGACCTGA
GTATCTAAATTACTAACCTAGAAAATTGTGATGCTTGATGAAGTAGAGGAGGTAAAGATT
GCTTCTGGAGAAGAAATGGGGCTCCAACTAGAAAATTAAAAAACATCCTATAAGGATATG
TAAATGAAAGAATCATGTGAGGAAGTTGAAAACTTAAAATG


invisible?    
Gene introns: 0  

>762 119 433     3q12.3    chr3:101262367-101262440 BLAT!
AAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACGCGGGGTAGTCAGGCATAAAA
TGCCTTTTAAATAATTGCCCCAGGCTGGGCATGGTGGCTCACACCTGTAATCCCAGCAC


invisible?    
Gene introns: 0  

>8206 193 433     14q21.2    chr14:44082112-44081920 BLAT!
TGTTCAATTTCTTTGAAAAGTAGATGGTTGGTATGGGTTCTGATCCCAATTTCTGGGTTA
GTATTCCCACAGTTATGCCCTTTTTTTCCTGCTATATACAAGGAAAAATGCTTAATGAAG
TTTGGGATGCCAAGAGTGGGAGCTTTGTTAAGAGCCTGTTTTAACTTGGCAAAGTTTCCC
CTCATTTCTAGGG


invisible?    
Gene introns: 0  

>23182 165 433     2q31.3    chr2:181672620-181672456 BLAT!
AAATCACCGAGGAAATAAACCTCTATTACTAAAGTTGAGAAGGAAACGTGATCCTTGTCA
CCAAACATGTATATTTTTATGCTATGCTTTTGTCTTCTAAAGGAGTTATTTTATGCGAGG
ATGAGGATACAGACCTTCTGACAGGCAACTTTCAGTCCTCAGTGT


invisible?    
Gene introns: 0  

>27211 143 433     8q13.3    chr8:72023903-72024045 BLAT!
GGGTGAGAAAAATGTGCTAAGACTGGTCATATGGGGAGAGAAAGAATCTGGTTGTATTCA
GGAAATCTGCACTGTGATGCTATCTGTGTGAACTAAGATTTACTTCCTGACTCTTCCTCA
GACGTGATAAATTATAGATGCCA


invisible?    
Gene introns: 0  

>11285 102 432     15q24.3    chr15:77276934-77277035 BLAT!
CCTGACCAACATGGTGAAACCCCATCTCTACTAAAAATATAAAATTAGCCAGGCGTGGTG
TCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCGGG


invisible?    
Gene introns: 0  

>11502 101 432     6p21.31    chr6:34181810-34181910 BLAT!
CTTGAGGCCAGGAGTTTGAGACCAGCCTGGGCAACACAGCAAGACACCCCCTTCCCCCAT
CTCTACAAAAAATTTAAAAATTTGCTGAGTGTGTTGGTGTG


invisible?    
Gene introns: 0  

>24819 178 432     2p23.1    chr2:31387131-31387308 BLAT!
CTTGGTTAACAGACCTAATGCAATATCACTAACTTGGTTCTATCAGTAATAAAAATAGTA
TTTGAACTTTAGTTTTATTTCTCAACTTATTAAGTGTTCTTTACCACCACACACTCACAG
GAAGAGATATGTGATTTATTGAGGACCCCAACAGGTTTTGTGGAAAAATCACACGGTT


invisible?    
Gene introns: 0  

Shown 1711-1740 from 3142 sequences on 58 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs