Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1741-1770 from 3142 sequences on 59 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>19191 127 431     Xq27.3    chrX:143339210-143339084 BLAT!
GGTGGCTATGCTGAGGTTTTGCCAGGAAAAAAGATGCCACATGGGCTTGTCCTTGGGCCC
CAGGACAGCCAGTAACTGCATTTATGTTAGTGAGTCCAGTTTGGCCAATTATTGGGTTTC
CAATCCA


invisible?    
Gene introns: 0  

>20605 204 431     10q21.3    chr10:66220924-66220721 BLAT!
GCCATTATGATGTAAAATATTCTAAGATTTTATTTGGCAGTGGGATCTGTCTTAAGTATC
ATAGAAACCATGAATATCTCTTCGTTATCTATATTGATTAAACAATGTTTCTAGAATCTT
TTTGTTAGTGTTTTAGAATCCTCAGGATGAGAAAATGCTTATTCCAGCTAGGAGCAATAA
TAGCCCCTTTAATCTCAGCCTCCT


invisible?    
Gene introns: 0  

>21819 179 431     2p12    chr2:79133493-79133671 BLAT!
GAAAGAGACCCACTAAGCAAATCACCTGCTCATTAACAGGGACTATCATACCCACAATGC
TCACTACCTTAATGCCCAAACATACAGATAACCCTGTCTTCTCCTAGTCAAAGGTGGCAC
AGATAAGGACACAGTAGTCATGAGCTTTTGCCCACAGTAAACTGGATGATTACTGAAAG


invisible?    
Gene introns: 0  

>9923 167 430     5q13.1    chr5:67840718-67840552 BLAT!
CCCGCTTCCACCCACAAATTCATCCAGAAACTTTTGCCTAGAGGAAAATTCAAGACTTAT
TTCTTTAATGGTCAGAATTGTGCTAGGTCAAGACTTTTAACTGTGTATTTAATTAGTCAT
CTGTATGCATGTAACTTAAAGGCGTTCAGCTGTGCCTTTTTATAGGA


invisible?    
Gene introns: 0  

>11020 164 430     4p15.33    chr4:11310824-11310987 BLAT!
GAACCAGGTGGATAAATCTTATTAGACCCAAAAGGTAAGTATTATTGGCTCTATTTTACA
GGTAAAGTCATGGAAGAACAAGGGTTTTAGGTGATTTGCTCAAAATTCTTCAGCCCAAAG
AGCTCAAAGGAAGATTAAGAAGCCAAGTCTGTCTGAAGTCAGAA


invisible?    
Gene introns: 0  

>13359 144 430     20q12    chr20:38544693-38544550 BLAT!
GGTAGTAGGAAAAGTATGTATTCTTTATTACAACAAAAGCAACAGTCCTTCAATGTGAAA
CTTTCCTAGTGTTTTCAGTCCAGCTGGGATGAACTACCTTTTGAATGGTGCTGGAGCATT
CACAAGTGTTCCTGTCTAAAGACA


invisible?    
Gene introns: 0  

>15867 158 430     13q31.1    chr13:80159511-80159354 BLAT!
ATTGGCAAATTGTATTTTCTAAAGGTGGCCACACTTAATATCTATCCCATCCCATATGCT
CTTCTTACAAAGTGATATCAGCACACAGACCTTGTAACTGTCCCAACTGATAGTATGTTA
CAAAAATGAAGCTGCATGACTTCTGAGGGTAGATTATA


invisible?    
Gene introns: 0  

>19403 161 430     Un_gl0002210    chrUn_gl000221:26400-26560 BLAT!
CTTCAATTTTCCTTTAGCTCCCACACATGAGTAAGAATGTGCAGTATTTATCTTTCAGTG
TCTGCACTTAACATCCATCAGACTGATCCACGTGGCCACGAATAACAGGATTTAATTCCT
TTATATGGTGAATAGTATTCCACTGTGTTTGTGTGCCACAG


invisible?    
Gene introns: 0  

>28064 169 430     4p15.33    chr4:12577648-12577816 BLAT!
AGAAGAGATGAAAGACACAACAAAACAAAAATCAACTTTAGAAAAAAGAAAAACCAGGAC
TAAGAGAAGAGAAGAAACACAAGCTAGAAAGAAGTGATAGATATTAACTAAAATTTGGCA
AGTAATTAGTAGGACACTTGGGCCAGGAGGGTAGAGAAAGAAAAAAATA


invisible?    
Gene introns: 0  

>5178 109 429     1q41    chr1:221281177-221281285 BLAT!
GTAATCCCAGCACTTTGGAAGGCCAAGGCAGGTGGATCACGAGGTCAAGAGATGGAGACC
ATCCTGGCCGACATGGTGAAACCCTGCCTCTACTAAAAATACAAAAATT


invisible?    
Gene introns: 0  

>5692 183 429     17p13.2    chr17:6184388-6184206 BLAT!
AAAACCACCACAGAGGCATTGCATTTTTGTGCTGCTCTCTCGCCTTTTCTTGCTAGGAAA
ATGGCATGTCTCAGACAGAGACTGTTGCTCCAGCCTGAATCCTGGATCCCGCCAGTGCAG
GAGAGTTGCAACTAGATCTTGCTGTTGCAAGATTCTGAAACTGAGAGGTTGTTTGTTACT
GCA


invisible?    
Gene introns: 0  

>16070 134 429     9q22.33    chr9:101775513-101775646 BLAT!
GCTTTTTAAACTAATTTTGTTGGGGGTTCCCTGTAGGGTTGCTGCATGTCATGGGGGGGT
CAACCCCCCAAGACACTCCCACTTGCCCTCCAGTCACCCAGGGGCACCTTTCAGCTGGGA
GGTGCAAAATGCCC


invisible?    
Gene introns: COL15A1 (101706137 - 101833068)  

>20343 213 429     4q22.1    chr4:90319250-90319462 BLAT!
GTGGAAAAAACAAATAAATAGTCATTTTTGAGCTGTGTCAGTTTTGAGCTATTTACTAGA
AAAACTTATTTAGATATGGAGTAGGATTTAGACATATAAATCTGTAGCTCCAGAAACAGA
GCAAAGCTAGAGGAGTAGTTTTGAGAATCATCACTAATTGATGGTATCTAAAATGATCAG
CTTGGAAGAAGGCACAAAGAAACAGTGTGTGGA


invisible?    
Gene introns: 0  

>23561 159 429     21q22.3    chr21:46247938-46247780 BLAT!
TGCTGTTGCTGTGGTCACCTTGAGGGTAGCATGACCTTGAACTTAGGGTTGAGGATGGTT
TGCTGCAGGACTTTTCTCAATGAGCCTGCTCTGCACCTTTAACTTAGGTCTTCTTTGCAT
GTCTGCCCTTGAGACAGGGCCTGTTGGTGCCCCTCACTC


invisible?    
Gene introns: 0  

>15224 165 428     5q21.1    chr5:101453436-101453600 BLAT!
AAGATAAACATGCAAAAATTTTGAGAAACATTGAATACAAGATTCAAACTGATATTTATA
TTGAATGCACACAATGTTCAGATCTTGCTCTAGAAAGTCTCTGCTTTTAACTATTACCCT
TTATGGTCCCTTGCCAAATGAAGAAAGCAATGTCCCTCTTCTCCC


invisible?    
Gene introns: 0  

>8915 133 427     13q21.2    chr13:62203077-62203209 BLAT!
AGGCATTGCTTAGCTGGCAGTGGGCTGTGCCCAGTTTGAGCTTCCTGGCCACTTTGTTTA
CCTACTCAAGCCTCAGCAATGGCAGACGACCCTCCCCCAGCCAGGCTACCACCTTGCATT
TCGATCTCAGTCT


invisible?    
Gene introns: 0  

>15445 154 427     7q11.22    chr7:67128111-67128264 BLAT!
AAATAGACTTCAGTTTGGGATTCAGTAAGCTGTTTTGTAGCCATGGCTAGCATTTGATTA
AAGTCACTGTCATGTGGGGATCTATGGACAAGCATCTTTTCCTTGCAGACATCCATTCTC
AGGGAATGCTCTTACCAAGCTGTTCTGCTTGGAG


invisible?    
Gene introns: 0  

>19491 153 427     18q21.2    chr18:51316894-51316742 BLAT!
TCTCTACATCAGCAAGGTTGGTCTACTTATTGTCACTCAAACATGAATTTTCTATTCCCA
CCTTACTAGCTTTCCAAATGCCATTATACTTACCCAATACATATTTCTCTTTCCCCTCCA
TTTATTTAAAATACTAAGTCTTCCAAGGACTGG


invisible?    
Gene introns: 0  

>23126 168 427     8q24.23    chr8:137475627-137475794 BLAT!
AATAGAACGATATTGGTTCTACCGTATTCCGTTGGTAAATCAGTCACAGAGCCCAGATTC
AAGGGGAGGAGAACCATAAACCATGAGGTTAGGGAAGATTGTCAAGGAATTTTGAGGCCA
CATTTTAAAATAGCTAGTCATCCCTCTGGGATCAGATGAGTCCTCCCA


invisible?    
Gene introns: 0  

>28526 126 427     8p21.3    chr8:21167711-21167586 BLAT!
GAAAGGCACTGAGGCCTTTTTTTTTCTTTTTGTTTTAAAATCCTCAGCCCCAAGGGCAGT
GCTATGCTCAGGGGATGGTCTGGGCTTCCGCCTCCAGAGCTGGTTCCCAGGTGAAGGTGA
CAGTGA


invisible?    
Gene introns: 0  

>13369 151 426     1q32.1    chr1:201542203-201542354 BLAT!
AACTTTGTTTAAAGGCCTGACAATGTTCATTTGTGTTGATCAAGCTCAGACTGAATTATG
CATAGGCACATGGCCTGTGCCTGAGGAATTTACCATGTAGGCCAGACACCCTGACTGATT
CAAAGGATGTCAGACAGCAGGACATCAAGTC


invisible?    
Gene introns: 0  

>24863 146 426     1p21.3    chr1:97012264-97012409 BLAT!
ATTAGGTGCCAGACACTAGATTGCAAATATTTCAGAAATTTAAAAGAATCCAGGTGCTTT
TAAAGCAAATATGTTGCTGGGATATAATAATGGTAATGTAATTCTTCCATAAATGGGACA
TATGTAATAGAACGAATTCAGTGATT


invisible?    
Gene introns: 0  

>15335 168 425     10q23.32    chr10:93426784-93426951 BLAT!
GGCAGCTTTCTCCAGATGGCAAGTCAGGTCCATGACCAACACGTTGGCAGTGGAGACATG
GAAGGCCATGCCAATGAGCTTCCCATTCAGCTCGGGAGTAACCTGGCCCACAGCCTTGGC
ACCACTAGTAGATGTAGGGATGATGTCCTGGAGAGCCACATGGCCATC


invisible?    
Gene introns: 0  

>23129 105 425     1q23.1    chr1:158710138-158710034 BLAT!
TATACTCAGAAAGTTCAAAAACACATTTTATCGTTTGAGATAAACGTCCCTGCCTTCCTC
CCACAAAACTACACTAGCATTTTTAAGAGCTGAGTAAATTGTCTC


invisible?    
Gene introns: 0  

>10251 169 424     21q21.3    chr21:29789335-29789502 BLAT!
ATGAGGGAAAGTTTATGCTATCTCTAAAATATTGCAAATGGTTCTCCCAGTCTTCCTCTT
ACCTGGCTGTGCTTCTGGCCAAAGTTGAGAAAATGGAGAAGAAAGCTCATGGCCCCTCAA
GTAGCCTACCATACAGCGGAGAGCACCTGTGTGGACAAAAATTACAATG


invisible?    
Gene introns: 0  

>19112 176 424     10q23.2    chr10:88134057-88134232 BLAT!
AGAATGGGACTTTTATCCCCACTCTACAGATGAGATCATCAAGTCTCAGAGCAGTAGTCA
CTGAACAGTTAATGAAAAATAGCCCCCAACAGATGTCCACATGCTAATCCCCAGAATCTG
TAGATGAGACCTTATTTGGAGAGAGGATTTGCAGATTTGATTAAGTCAAACATCTG


invisible?    
Gene introns: 0  

>25973 153 424     12q14.1    chr12:58554673-58554521 BLAT!
ATTTTAATGATATTCATAGAACAGAGAGAATTATGCAAGCAATTTTTTTAGTCATTTTAC
TCCTTGGCATCTCTTTTAGAGATAATAAGTTGTAGACCTAATTTCTTAATGAATTGTATT
TACAATCATCTGTAAGCCTACTTGTCTGATACA


invisible?    
Gene introns: 0  

>5877 188 423     2q14.3    chr2:124081023-124081210 BLAT!
GCTAAGCAGAGAAAGCTACACTAATATGACTTTTTAAATGTGAGTGAAACTCTCATTTGA
AACCTTTCCACTACATAACTCCACTCAATTGGTTTGATGGCTCAAATACACACAGGCTGT
AGGTTAAAATAGGAAGAGAGGGCTGAAAACTCTTATAATAATGCTAAAGTTGAGGCAGAA
TAGCACAT


invisible?    
Gene introns: 0  

>10870 115 423     2q24.1    chr2:158246458-158246572 BLAT!
ATGTGTTCTCATTGTTCAATTCCCACCTATGAGTGAGAATATGCATTGTTTGGTTTTTTG
TTCTTGCGATAGTTTACTGAGAATGATGATTTCCAATTTCATCCATGTCCCTACA


invisible?    
Gene introns: 0  

>28284 207 423     6q27    chr6:166507453-166507247 BLAT!
GGATACAGAGAATATGCTGTATATACACCATAGACGGCGACGCAGCCATACGAAAGAATG
AGATCATGTCCTTTTCAGGAACATGGATGGAGCTGCAGGGCATCATCCTTAGCAAACTAA
TGCAGGAACAGAAAACCAAATACTGCATGTTCTCACTTATAAGTGGAAGCTAAATGATGA
GAACACATGGAAACAAAAGGGGGAACA


invisible?    
Gene introns: 0  

Shown 1741-1770 from 3142 sequences on 59 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs