Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1771-1800 from 3142 sequences on 60 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>30249 153 423     2p16.2    chr2:53760313-53760161 BLAT!
TACCCAAAGGATTATAAATCATTCTACTATAAAGACACAAGCACACGTATGTTTACTGAA
GCACTATTCACAATAGCAAAGACTTTGAACCAAGCCAAATACCCATTAATGATTGACTGG
ATAAAGAAAATGTGGCACATATACACCATGGAA


invisible?    
Gene introns: 0  

>3489 158 422     4q25    chr4:113373773-113373930 BLAT!
AGGGAGTGGGAAGTGCAAATAATAACAGTAACACTAACAATTATAATAGATTATGTTTTG
TGGTTATTTACTGGTGCTTATGCATCATTATTATATCACCCCGAAATATTCTTTAAATTG
CTGTTTTTGCCAAAATAGTCTAATATTGGTAAATTCAT


invisible?    
Gene introns: 0  

>8460 192 422     2p24.2    chr2:17513796-17513605 BLAT!
CTCCCAAATTTTCCTCTGCTCAAAGAGAAGCTTTCTGTGTCTGATGGGAGTGCTGAGTCC
ATGGAAAGAGGGGTATGGACATGTGTTCAAGAGTCAGTGAAATAGTGGATGAAGCTTTTC
TTCTATGCCTTAAACTCTACATGTCAGAAAATATCCAGTAGCAACTTTACTTTGATTTTA
TGTTTTATTAAA


invisible?    
Gene introns: 0  

>24654 188 422     1p36.21    chr1:14550322-14550135 BLAT!
GATTGGACCCAGGGTGGACAAATCAAGCCAGATAGATGAGGTTTCCCTCATGTGCAAATA
CTCTTAATTAATCCAGTGTTTCTCCTTTCGTATCAGTTTCATCGTCGAGAGTCTTGTATC
ATCTGAAAATTCAGTTTAAAGAAGCTTAACTGTAATTTATGCAGGATTTCTTGTCAAATT
TGGCCTAA


invisible?    
Gene introns: 0  

>25832 218 422     7q35    chr7:145103954-145104171 BLAT!
CACTGCTTTGAGTAGTGAAACGAAATCTCCCACCTGAATCATTCTTTTGTTTGGTGTATC
CACACTGAAGATGCCATTCACCCATTGGGCATCAACATTGTCTGTTCCTGACATCCACCC
ACCAACATCTTCATGGTTGGATAATTCAGGATCACCTAAAGCAGATGATGCTCCTTCTGA
CATGTCATCAGAAGGTCAATAGTAGCCTAACACCATGT


invisible?    
Gene introns: 0  

>3536 129 421     13q13.1    chr13:32768653-32768580 BLAT!
GGCAGTGACGTCAAGCAGCTTGCAAGTAGCAGGCACGCAAACAAAACCAGTGCGTGGTAC
TATAACAACAAATCATTTCCTGATAAAATGAGAAAAACCAATGGAACTGCAACCTTACAG
GGAGTAGTT


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>11367 189 421     4q13.1    chr4:60543954-60544142 BLAT!
AATTTTTGCACTAAATTATTATTGTGCATTGAAAGCCTCTGTGGCAGTCTCAGAAATGCA
CCACTGAGATGCCCTAATAATTGTCTGATATGGATCCATCTGCTGCCACTCTGGATTCCA
CCACATTTATGCCTAGGCAGTGCTGCAGCTGATGAATGAGCACTCTTGAGGTTCTAATGA
AGACCATTT


invisible?    
Gene introns: 0  

>26861 158 421     Xq25    chrX:122131212-122131369 BLAT!
TCTATAGATCTAACCTTTACCATTAGCCCAGACTTAGTAACTCTACCTTTAATTTATGAC
TCAATCCACAGTCTTGGTGCTGACAGGTAACAAACTACAAATTACTTTGTGAACAAAGAT
AGGACATCAACTAAGAACAAAACACATATTTGCACTCC


invisible?    
Gene introns: 0  

>27141 168 421     4q13.2    chr4:66690305-66690138 BLAT!
CAAAACTCTCCTAGCTTAACAAGTATCTAGATGCTAAATAATAGGTTTATAAGCAGTAAT
AATGTGTAATTAATATGTCAAGTGCTGTCAATATTTCAAGCAGAATGAAGACTGCAAAGG
AAACATTGAATTTGTAATTAGGTGCCCCGTTTCAGTATGTTTACCAAA


invisible?    
Gene introns: 0  

>27571 184 421     16p13.12    chr16:12737446-12737263 BLAT!
TGCCCAGGCTGGTCTCAAACTCCTGGGCTCAAGCAATCCTGCCGTCTCAGCCTTCTAAAG
GGCTGGGATTACAGGTGTAAGCCACCACACCCAGCCCCCATCTAACTGTTTTAAAAACAA
CTTTTCCTAAGTCGATTTCATCACAAACTCTTTTCCACCATGGTGGCACAGATTGGCTAG
CAGT


invisible?    
Gene introns: 0  

>32286 102 421     3q13.11    chr3:104844121-104844020 BLAT!
CCAAAGTGCTGGGATTACAGGCGTGAGCCACCGTGCCCGGCCTCTAATCTCTATCTTTTT
TGGAAGAAGTCTGTGTTGTAAATTCCCTTAAAACAACGGATT


invisible?    
Gene introns: 0  

>5133 189 420     Xp22.13    chrX:17895232-17895044 BLAT!
AACAAATATAATAAACCTTCTCAACTTCTTAACACTCTTTCCACCCTTGGCTTCAAGGCC
ATTCTTCACAGTCTTTCTAATCTCTCCTTTTACTTTGCCCACTCTTGGTGGCATAGCTAA
TATATTTGACACCTGCAGCAGATCATTTCCAAAAATGTGCTTGCTTTCTATGCCAAACGT
ATTTTTAGT


invisible?    
Gene introns: 0  

>5965 112 420     15q14    chr15:36660258-36660147 BLAT!
AAAAACAAAACAAAACAAAATAAAAACCCAGAAGCTAATTTCCTTCAAAAAGCATTGATA
TTTAGCGAACATAATGCTGGCTTTGTCTAGCTAAGTTGCCAATATTTGGAAA


invisible?    
Gene introns: 0  

>25868 125 420     5p13.1    chr5:39699095-39698971 BLAT!
TGATTTCTTTCCGTAACTCAGGCATTAAATGACTCCTCGTCAGGCCTTCTGTGACCATCC
TTTCTAAAGCATTTAGTTTGCCCCTGACTTCAAACACTGACACATTATCCTGGCTTTTCC
ATACA


invisible?    
Gene introns: 0  

>31121 161 420     4q32.3    chr4:168430166-168430006 BLAT!
CACACTCCTGAAATAATCTAAGGCCACTGCTAATCTGACAGGAGGCAGAGCTTAGGTGGT
AATGCTTGCTTGCCCACCACTCACCTCCTGGTGTGTTGCCCAGTTCCTAACAGGCCATGG
ACCAGTGGGGGTTGAGGACCACTGCTCTAAGGTTTCAGTGG


invisible?    
Gene introns: 0  

>4340 155 419     2q35    chr2:217911670-217911777 BLAT!
TAGCAGCTTTTCACGTTTCCCAGTCCCCATTAGAGGGCTTGAGACCTTGTACTTACTGTG
TGCCAGGAACTGTGCTAATTCTTTATATTATGCCCATAAAACCTGCTTCTGAAGCATTGG
GGGGTTTGCACTTGCCGTTCCCTCTGTCTGGAATG


invisible?    
Gene introns: 0  

>7119 174 419     10q26.12    chr10:121703807-121703634 BLAT!
GAAAGGCAAAGGGGAAGCAGGCACCTTCTTCACAAGGTGGCAGGAGAGAGTGCAGGGAAA
ACTGCCACTTTTAAAACCATCAGATCTTGTGAGAACTCCCTCACTATCACAAGAACAGCA
TGGGGAAACAGCCCCCATGATCCAATCACCTCCCACCAGGTCCCTCCCCTGACA


invisible?    
Gene introns: 0  

>23286 146 419     20p12.2    chr20:11407137-11406992 BLAT!
TATCTGGATGATATAATTATGAAGGGTTTTTTTCTCTTATAAATGTCTTCGTATGTGAAA
AAATTATTAAGTAAACCTGAATGAAGCTGCAAGAATCTTAAACATATAGCCTGAAATTCT
CAAAACAATGAGAGAAAATTTCTCAG


invisible?    
Gene introns: 0  

>24255 160 419     13q21.33    chr13:68941247-68941093 BLAT!
CTTTTTCTGTCACCCAGGCTTGAGTGCAGCGGTGCAATCCCGGCTCACTGCAACCTCCGT
CTCCCGGGTTCAAGTGATTCTCCTGGCTCAGCCTCCCGAGTAGCTGGGACTACAGTCGCC
CACCACCACGCCCAGCTAATTTTTTTATATTTTTAGTAGA


invisible?    
Gene introns: 0  

>26314 100 419     Yq11.222    chrY:19968842-19968930 BLAT!
AGCACTGAAGTTTAAGAAGGAAATTAAAACGGCTCTCCACGGTGGAAACCCAATTTGGTT
GTCCAGTGTCACCCTGGTGTTTGGGGTCCCCCGCGTACCT


invisible?    
Gene introns: 0  

>26828 196 419     12q24.11    chr12:109611613-109611418 BLAT!
AGCTGGACCATAGGTTAGCAAACTCTTTCTATAAAGAGCCAGATGGGAAATACTTTCAGT
TGTGCGAGCCTGCAGGTCTCTGTCACAATGACTCAACTTTGCCAGTGTTGGGTGAAAGCA
GCCATAGGCAATACATAAACGAATAAGCACGACCATGTTTTAATAAAACTTTATTTACAA
AGGCAAGCCATAGGCT


invisible?    
Gene introns: ACACB (109577201 - 109706030)  

>3472 137 418     Xp21.1    chrX:31775595-31775459 BLAT!
CTAAGGTATTTAGCTATAGCGGCCCAGACTAAGACAAGGGCTGACAGCTGAAGGCTGTCT
ACCAGCAGCACTCCTAGCAGCTGGGGAACTAAGTCCTTCATTTCCAAAGGGGAATCTAGG
CAGCATATTTACAGCTT


invisible?    
Gene introns: DMD (31137344 - 33229673)  

>20695 168 418     3q26.2    chr3:167897412-167897245 BLAT!
AACACTAATCATTTTTTTCATGAGCCATTGGAAGGCAGCAAGAATCACTAGGATTCCTTA
GCGCATCTTTTAAATTTCATAGAGCTCATAGAAATAATAAACACCATCTTAATCTTTTCT
TTCTTAGCCTTAGAAATATGAAATATCCTGCTGTGTATACTTGTATAG


invisible?    
Gene introns: 0  

>27732 159 418     5q12.1    chr5:62455439-62455597 BLAT!
ATTGTGTTAGCCTCTCTGGGTCTTTTGCCTTTCACAAAAGCTTTAGAATCAGTTTGTTGA
TATCTACAAAATGACTTTATAGCATTTTTATTGGGATTGTGTTTATAGATCAAGTTGGGA
AGATCTGACATCTTAAACAATATTGAGTCTTCTTATTAT


invisible?    
Gene introns: 0  

>4152 116 417     2q37.1    chr2:235303891-235303779 BLAT!
TAATCCCAGCACTTTGGGAGGCTGAGGCAGATGGATCACATGAGGTCAGGAGTTCGAGAC
CAGCTGACCAACAGGGTGAAACCCAGGTCTCTACTAAAAAAAAAAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>27486 162 416     20q13.31    chr20:55258681-55258842 BLAT!
GTGATGCTGCCTCTCTGTGGATCCCTGGCTCAGGTGCAGAATCCTGACCCAGAGGACACT
GACGCAAGCTTCTATTTTGGAAATCTGGAATCTGAATGTGGATACACTGGGTCAGTTGGC
TACAGGACCAGGGCTCAGCTGGCTTGTCCTGCGAGCTCCGGG


invisible?    
Gene introns: 0  

>32546 146 416     5q14.3    chr5:83224940-83224795 BLAT!
GATTGTCATTTGTATAGTTATAATTTAATGTGATAGGTATTGCTAAATAAAGTATAATAA
ACTAAAAGAGGTAAGAAATATTTTGACATTTGAAAGCATATCTATAAATTTTCCTTTGGA
TACCGTGTCTCTCCCTCTCTTTGCCT


invisible?    
Gene introns: 0  

>21829 162 414     13q31.1    chr13:79256065-79255904 BLAT!
GCTGCGACTATTCTGCTGGGCATTCCCTGTCTTTCCTTTTTTCCCTTTATTTTTGGTAGC
AAATGAAAGAAGAAATTACTGGACTTGGGTCTATTTTTTCTTCTCCAAATCCATTGGTCT
TATTGAGCTTTGGTGCTTGTGTTCACATTTATAAAAATAATC


invisible?    
Gene introns: 0  

>24627 155 414     5p14.1    chr5:24661193-24661039 BLAT!
GGGGTGCCACTATGTAACCCACATGGACCTAGTGGGACTGAACAAAGAGGGGGTGAACGT
GGGAATAAAAGACAAGAGGCAAAAAAGTATACTTGGAAAAAGGGGACAGGGTGCATCTTG
CCTCTAGTGGACAAGGGCCCTGAGCTTTACACAGC


invisible?    
Gene introns: 0  

>25303 136 413     12q24.32    chr12:129266004-129265869 BLAT!
TCAGTTGAACTAATAGCTCGGTGTCCTCGCTAGGGCTGCTGCAGGACCAGATTTCCACTG
ACTTCGTGGCTTACCCAACTGGAATTTATGCTCCCTGTTCTGGAGGCCAGAAATCTGAAA
TCACAGTATTGGCAGG


invisible?    
Gene introns: 0  

Shown 1771-1800 from 3142 sequences on 60 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs