Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1801-1830 from 3142 sequences on 61 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>9919 138 412     1p31.1    chr1:72876111-72875974 BLAT!
ATGAGGCCAGGAGCAAAGGAATGCAAGCATCCTCTAGAAGCTGGGAAAATCGATTATCTC
TTATCATTTCCAGAATAAAACACAGTTCTGCTGACACCTTGACCTTAGCCCAGTGTGACT
TCAGGACTCTGTTATTAT


invisible?    
Gene introns: 0  

>14532 130 412     1q25.2    chr1:179238865-179238736 BLAT!
GCTCTGAAAAGATCTTAGCTCCCTTGTAAGCACTGTAGCAGCCTTGTAAGCACTCTGAGG
CCCCCATGTTTTGAGCTCAACCTAGTCCATGTTGAGAGGTCACCTGCAGGGATCCTGAGA
TAACATGAAG


invisible?    
Gene introns: 0  

>19035 165 412     7p22.2    chr7:3215074-3215238 BLAT!
CAAGTCACGGTCATCATCTTTCTGGATTAGCAAGCAGGCTGACAGCCCTGTTCCTCATTT
TCCTCCTCCCGAAGGCTGAGGACACAGGCCTCATTACAGGAGCTACTGGCCCACAGAAAA
ATTATTTGCCCCCACTGATAGAAAATAAAAAGGGGGCTTTAGAGG


invisible?    
Gene introns: 0  

>23389 109 412     15q21.1    chr15:47234771-47234663 BLAT!
AAAAAATGTTAGCTGCCATGTTTATATAATGGGAAAAAATGAAGGAATATATAAACAATA
AATTAACATAAATCATAACTGCCCCATTTGCTGGCAATGTAAATTTTAC


invisible?    
Gene introns: 0  

>13643 165 411     5p13.1    chr5:42107051-42107215 BLAT!
ACTGAAGGACCCTCTAAGTCCACGCTTACCATGTGTCTTATGGGAAACCTGAGGTTGACA
TGGCTTTCCAGCCAGATGAACCTGGGAAAGATCCAAGGCTGTGAGCAAACACTGGACAAA
TACCTGAGTCCAGAAGACTGCCTCAGTGGCTCATACTGGCATACC


invisible?    
Gene introns: 0  

>19568 132 411     13q13.1    chr13:32767120-32766989 BLAT!
ATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAATGTGGTGAAACCCTATTTCCAT
TAAAAATACAAAATTAGCTGGACATGGTGGTGTGCGCCTGTAATCCCAGCTACTGGGGAG
GCTGAGGCACGA


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>23685 146 411     19q13.31    chr19:43936350-43936495 BLAT!
GTGGTGGCTCACGTCTGTAATCCCAGCATTTTGGGAGGCCAAGGCAGATGGATCACCTGA
GGTCAGAAGTTCTAGACTAGCCTGACCAATATGGTGAAACCCCCTTTCTACTAAAAATAC
AAAAAAAATTGCTGGGCATGGTGGTG


invisible?    
Gene introns: 0  

>29520 172 410     10p12.2    chr10:23858897-23858726 BLAT!
AATGCCCCATGGTATCAAGCTGATTCAAGGTTAAATTGATTAAGTATAGATCACATTGAC
AAAGAGATACAATTAAACAAAGGCTCGAGTCTGGAGAGTAATTAAAAGCCTCCTCCTTAT
TCAGCAGTCTAAGCTCCAAAGTTAGAATCAGGACATAGGAGGCCGAGCACAG


invisible?    
Gene introns: 0  

>9596 189 409     Xq22.2    chrX:102844835-102844647 BLAT!
GGTTTCTCACAGTTGGAGTAGAAGGTTACAAATAAGCAAGGGGAGGCTAGAATGATCCAT
GCAGTAATAGACTGTAGTTGGAGACACTAGTATAAATTTATGTTTAGCCTTATATAAATA
CAGATGGTTATATACAGAAATATTTATATTTCCATAAATACTTTATATATGTATGGGTAT
TATATACAC


invisible?    
Gene introns: 0  

>15840 146 409     5p15.2    chr5:13770170-13770315 BLAT!
AGGAAGGAACTAGCTGCCTGCCTGAACCTGAAATAACGTGACCATAGAGATGGGAACCCT
CCGAGTCATTTCGTGTAACTTCCCACCCAGGGATTCCTTACTCTGGCTGATTCTAGCCAC
GCTCAGGAAGATGATCTGATCAGAAA


invisible?    
Gene introns: DNAH5 (13690436 - 13944589)  

>31203 129 408     Xq21.32    chrX:93209568-93209440 BLAT!
TTTTTGAGACGAAGTCTCACTCTGTCACCGAGGCTGGAGTGTAGTGGCGTGATCTCGGCT
CACTGAAAGCTCCGCCTCCTGGGTTCACCCCATTCTCCTGCCTCACCCTCCCGAGTAGCT
GGGACTAAA


invisible?    
Gene introns: 0  

>3548 183 407     16q22.2    chr16:72040193-72040011 BLAT!
GGAGCCATTGTGGACGTTCCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTT
GGTAATGCTATTGATGGAAAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTG
AAAGCCCCCGGTATCATTCCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAG
GCT


invisible?    
Gene introns: 0  

>8136 143 407     12q15    chr12:71031094-71031236 BLAT!
TCAGGACACTGAGGCAGACCCACTCACCTGAGTTCCTGAAGATCAAGCAGGTAAGAATCA
CCATGTAAAATTCAGCCTCCATTTTCCACTTAGCAACTGTTCATGCTTCGCTTGGGGAAA
AAAAAAATTCTCCCAGATAAGAG


invisible?    
Gene introns: PTPRB (70910631 - 71031219)  

>9234 162 407     10p12.31    chr10:19181791-19181630 BLAT!
TGGAAGCCAAACGTCTGAAATCAAGGTGTTGGAGGATGGGTTTCTTCTGGAAGCTCTGAA
GAATCTGTTCCATGCCTCTCCTAGCTTCTAGTGGTTGCTGGCAATCCTTGATGGTCCTTG
GCTTGTAGACACATCACTGTGATCTCTGCATCTGCCTGCACA


invisible?    
Gene introns: 0  

>12588 101 407     15q21.1    chr15:47097805-47097705 BLAT!
ATTTAAGTCTTTAATCCATCTTGAGTTAATTTTTGTATATGGTGAGAGGTAGGGTTCCAG
TTTCATTCTTCTGCATATGGTTAGCCAGTTTTCCAAGCACC


invisible?    
Gene introns: 0  

>25883 131 407     12q14.1    chr12:61820612-61820482 BLAT!
AATCCCAGCACTTTGGGAGGCTGAGGCAGGTGGCTGACCTGAGGTCAGGAGTTTGAAATC
AGCCTGGCCAACATGGCAAAAACCTGTCTCTACTGAAAATACAAAATTTAGCTGGGCATG
ATGGCAGGGGC


invisible?    
Gene introns: 0  

>4128 170 406     7q31.1    chr7:112649145-112649314 BLAT!
GGAAAAAGCATGGTTTCCTGGGAGGGATAGCACAATCATTCACCACCTCCCTTGGTTTGG
GGAGGAGCTCCCCTTGCCCCACGTGGCTCCTGGGCTTTACCTCACTTTCCATGGGTCATG
CCAACCACCTAGTCAGTCAAAATAGGAGAACCTGGATTCCTCAGCTGAAA


invisible?    
Gene introns: 0  

>8317 144 406     4q32.3    chr4:166575421-166575278 BLAT!
GGGTCACCTATCCTACAGCCATTTGTGAGATCTGGACACAGAGCATGTGGGCATCTTTGT
TTATTCATGATCACAGGGTCTCTGTGGGTCCTCTAAGTCTATGGCTTACTAAAATCTGTA
GCCATAGAAGCTATGAGAAACCGT


invisible?    
Gene introns: 0  

>17304 162 406     2q32.3    chr2:194276953-194277114 BLAT!
TGCTGACTTCAGAAGTGAAGCTGCAGACCTTCACAGTGAGTGTTACAGCTCATAAAGGTA
GTGCGGACCCAAAGAGTGAGCAGCAGCAAGATTTACTGTGAAGAGAGAAAGAACAAAGCT
TCCACAGTGTGGAAAGGGACCTGAGCGGGTTGCCGCTGCTGG


invisible?    
Gene introns: 0  

>23066 146 406     1q31.2    chr1:190896379-190896234 BLAT!
GGATCCCAGTGTGTTCTCCTGGGTTCCAGTTTGTCTTGACTTTCACCTCCTTCACATCCA
AATTTTCATTCCCTCTAATGACCTTTATTGATCTACAAAACTTAAGGCCCAGTATCAGAT
GTAACAGTCATATGTAAAGTCTTTGA


invisible?    
Gene introns: 0  

>29560 193 406     2q36.2    chr2:225532921-225533112 BLAT!
TAAGATGTCATTGTTAAGACATAATAGTAATCAGTTAAGATGAGGTCATACTAAAGTAGG
GTAGGCCTCTAATCCAACATGATTGTTGTCCTTACAAAAGGGGGAATTTGGACACGGACA
GTCTCATGGGGGAGAACACCATGTGAAGATGAAGGCAGAAATCTACAAACCAAGGAGTGT
CAAAGACTGCTAG


invisible?    
Gene introns: 0  

>4505 136 405     11p12    chr11:42626474-42626339 BLAT!
TATTACTGCTCATACCAGAACCCTTGGAAATAGGTTCTGTTATTGTTTCCATTTTACATA
GTGGGAAAGTAAGTGTGTGAAAATTTGGCATCTTATCCAATTTCATGATGCACTAAGAGG
CCAAAACCCGGGGCTA


invisible?    
Gene introns: 0  

>3263 146 404     8q24.3    chr8:139949763-139949618 BLAT!
ACCTCCCACTCCCAGAAAGTCAGTCTTTTGTTCTATTCAGGCCTTCACCCGATTAGACAA
GGCCCACTCACATTGGGGAGGGCAATATGGTTTACTCAAAGTCCACTGATTTCAATGTTA
ATCTCATCCAAAAATGTCCTTACAGA


invisible?    
Gene introns: 0  

>9859 112 404     10p12.1    chr10:27636574-27636463 BLAT!
CAATTAGCCCATTGCCAAAAGGTTTTACTGTCTTAAAGCCAGAACTGTCTTTCTGAGATC
TAATTCCAAGGACTCCTCCACAGCTAAGTGAGATGCCTCACACCAGTATTAG


invisible?    
Gene introns: 0  

>10784 134 404     Xp22.2    chrX:11169815-11169682 BLAT!
AACATTTAGTGATATTTGGGAACTTAATATTTTGTTTTGATTTGGGTTTTTCACTTCTTT
ATGCAACATCGGTATTGGAGGAGTTAAAGGATAATTCCTTGTTTTTTCTCGTGCTTGTCT
GCTTAAGTATTTGG


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>3284 168 403     3q28    chr3:190537250-190537083 BLAT!
GGAATATGAGCAATCAATCATTCCATACGATGCAGATATGGGGAAGGGTGGATGCAGATA
TGGGGAAGGGTGATTGCAGCTGTTGCATGGAAAGCACAAAGCCCACGTAGATTCTTCTCC
TCTAAATCTCTTATAGAACAAAATACTTGCACCACTGATAGAAAGATA


invisible?    
Gene introns: 0  

>3437 136 403     4q28.1    chr4:125384434-125384557 BLAT!
ATCCACGCGGCGAAGCCCCAGTAGTAGGTGCAGTTCTTGAAGATGTTGCGCAAAGGCATA
GTGCCATGGGAGAAGCGGTGCACGAAGAGCGTCTCCAGCAGGCGCTTGATGTAGTGGAAT
GAGTGACAGATGCAGG


invisible?    
Gene introns: 0  

>7719 169 403     4q31.23    chr4:149530824-149530656 BLAT!
TCTGCATACAATCAACAAAATGAAACAACATCCTACAGATCAAAAAAAAACTTGCAAACC
ATATTATCAAATAAGGCGTTAGTATTCGAAATTTATAAAGAACTGAGACAGCTTAATACT
AGAAAAACAAATAATCCTATTAAAAAATGGGCAAAGGACCCAAACAGAT


invisible?    
Gene introns: 0  

>24682 200 403     6q26    chr6:164221492-164221293 BLAT!
CACCTGTCACCCAAGCAGTGCACACTCTACCTGATGTGTAGTCTTTTATCCCTTACCCCT
CCCACTCTTTCCCCCAAGTCCCCAAAGTCCACTGTATCATTCTAATGCCTTTGTCTTCAT
AGCTTATCCCCCACTTTTAAGTGAGAAGACATGATGTTTGCTTTCTCATTCCTGAGTTAC
TTCACTTAGATTAATGGTCT


invisible?    
Gene introns: 0  

>26167 150 403     16q22.2    chr16:70884000-70883851 BLAT!
CTGACTCCATTAAGCTAAAGATAGTCAAATCACCAACATCATCTGCCATCCTTATTTCCC
AAAGGATATTTTTCATCAACATGTTACAAATGCTGACCCCAGACAAGGGAACTATGGTTT
GCATTCACTGCTCTGTTCTCTGTCTCCTAG


invisible?    
Gene introns: HYDIN (70841288 - 71264569)  

Shown 1801-1830 from 3142 sequences on 61 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs