Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1861-1890 from 3142 sequences on 63 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4380 140 394     3q12.1    chr3:98378547-98378686 BLAT!
GGGCAAGAACAACTATTGTCTGCAGATAAATCCAGCATCAACCATTAATCCAGACCATCT
TTCATACTTCTGTTTCATTGATCGTTTTATTGCCATGGCACTATTTCATGGAAAGTTTAT
CGATACTGGTTTCTCTTTAC


invisible?    
Gene introns: 0  

>10103 149 394     13q14.3    chr13:54060817-54060676 BLAT!
TGCTTATGATTCCAGTTTTATTATAAAGGATATACCTAAGTAAGATCTGAAAGGGAGGCT
GGGCATGGTGGCTCACGCCTGTAATCTCAGCACTTTGGGAGGCTGAGATGGGCAGATCAC
CAGGTCAGGAGATCGAGACCATCCTGCCT


invisible?    
Gene introns: 0  

>15306 149 394     5q23.3    chr5:128601234-128601086 BLAT!
CTTTTACAAATTAGTAGCCAGGGACACAATCAATAGTGAAAAGTGAAGACCTGTTTGGAG
TATAGTAAAGCACAAATGTAGGGTATAAAAATGGGAATCAGAAGGTGAGTCTTTTGAAAG
ACTGCAAATGCCAAGCTGTGGAGCAAATT


invisible?    
Gene introns: 0  

>21366 152 394     3q26.33    chr3:179344446-179344597 BLAT!
GTAGCTGGGATTACAGGTGTGCACCACCACACCCAGCTAATTTTTTTGTATTTTTAGTAG
AGAGGGGGTGTCACCATGTTGGCCAGGGTGATCTTGAACTTCTGACCTTGTGATCCACCC
ACCTTGGTCTCCCAAAGTGCTGGGATTACAGG


invisible?    
Gene introns: 0  

>2364 137 393     3q25.2    chr3:152557406-152557270 BLAT!
TGCTGTATTTCTTCTTAGTTTGTCTTTTTGTCATTTCAATGTAAACACAAATTGATGTTC
AAAGAGTCAAAGATGCTGATTTGTAAGCAATAAAACACCTTGAATTTGCCATTAAAATAT
TTTTTATGGTGTGAAAT


invisible?    
Gene introns: 0  

>3080 127 393     13q21.2    chr13:59861292-59861166 BLAT!
CTCAATAATTTTGGAAATTAAGAATGCTGAAATTTCCATAAACATTAACGTTTTTAGAAT
ACTTAACATGTGTGCTCACATTTCAGCCTTTGTTGCCTTCCTAGGATTTTTTTTAAGGTT
CACACAC


invisible?    
Gene introns: 0  

>3513 153 393     10q23.1    chr10:86380971-86380819 BLAT!
TAGCCATTGGGCAAACATTCCCATTCCAAAAGGGAGAAATTGGCCAAAAGAAAGGGGCTA
TGAGTTTCATGCAATTTTGGAACCCAGGAGGGCAGTCATTAAATCTTAAAGCTCCAAAAT
AATCTCCTTTGACTTTATGTCTCACATCCAGGG


invisible?    
Gene introns: 0  

>17425 121 393     3q12.3    chr3:101262525-101262405 BLAT!
TTAGTAGAGATGGAGTTTCACCATGTTGGCCAGGCTGGTATCGAACTCCTGATCTCAGAT
GATCCTCCGGCCTCAGCCTCCAAAAGTGCTGGGATTACAGGTGTGAGCCACCATGCCCAG
C


invisible?    
Gene introns: 0  

>29686 141 393     6p22.3    chr6:16832482-16832342 BLAT!
CAATGTTGTATTGCCAAACAGTAATGATTAGGAAATCTGCAAGCCCAAGTTCCAGTTAAA
TGGAGGGCTGGACAAGCTCAGCCTGGGGCTCAGAATTTAATCACACTCTCCTGCCTTGAT
ACATATCACCATACCTGGCAC


invisible?    
Gene introns: 0  

>29978 161 393     6q16.2    chr6:99623057-99623199 BLAT!
GAGCGGCCGCCCGGGCAGGTACAGCACAACCAAGGCAGCCGTGATTGGCCTCACAAAATC
TGTGGCTGCAGATTTCATCCAGCAGGGCATCAGGTGCAACTGTGTGTGCCCAGGAACAGT
TGATACGCCATCTCTACAAGAAAGAATACAAGCCAGAGGAA


invisible?    
Gene introns: 0  

>5923 181 392     5q34    chr5:161931376-161931196 BLAT!
TATCACTTCTGTGCCCATCTCTTGGCCTGAACCCAGCCATATCATCCAATTGCTAAAGGA
ATTTAGTCTTTCGAAAGTGTTTCCATGAAGACAAAAGTTCAGTGAGCATGTAGCCTGTGT
TTTCAATATCGAGGATGATTATTCTCAAGAAATCAGTTCAATTAATTCCATGTAATGATA
A


invisible?    
Gene introns: 0  

>8993 127 392     5q23.3    chr5:130008845-130008719 BLAT!
CATACAAATTACTTAGAGGCCAACCTAAATTTTTACTGCTTTGATTCTATCTATCTATCT
ATCTATCATTAATCTATATTATCTATTATTTATCATCACCTATTTATTGTAATTGCTTTA
GTTTCTT


invisible?    
Gene introns: 0  

>9563 183 392     9q22.31    chr9:94473964-94473784 BLAT!
CATACACCACACACAGACACGTATTCTGCAAACACCACACACATTCACACACACACCATA
TACACATTCACATGCACACTTATACACACACACCACACACACCACACACATCTTGCACAC
ACCACACACATACACACCACATCAACCCACACCACACACACACTACACACACACACACCT
CAT


invisible?    
Gene introns: 0  

>16437 130 392     5q13.1    chr5:67841108-67841237 BLAT!
AAAGGAAAACCCAGACGAGGACCCAGAAGCGACCTCTAGAACATTAACCTTTCAGAGACA
CATTCATTGCTCAGGCTGTGTTGCCAGGAGACACAACATATTTAGATGGGGGGGTGTAGG
GGGAGGAAGA


invisible?    
Gene introns: 0  

>20412 114 392     21q21.3    chr21:30112225-30112112 BLAT!
AAATTTCCCATTTCTACTTATGTTTGGAAAACCTTGGGTGTGTATTTTCACTGTGTATTT
AACCTTCTTTCCTGGCTTCTAGAACTGTGCTGTCCAATATGGTAGACACTGGCC


invisible?    
Gene introns: 0  

>23303 209 392     Yq11.21    chrY:13842768-13842827 BLAT!
TTGAGTGGATCGAAGTGCAGTAGAATGGAATGGAATGGAATGGAGTTGAGTGGAATGGAA
TGGAATGTATTGGAATGCAGTGGAGTGGATTGGAGTGGAAGGGAACGGAATGGATTGGAA
TGAATGGAATAGTGAAATGAAATGTGAGATAAGATTGTGCCACTGCAGCTGGGCGCGGTG
GCTCACGCCTGTAATCCTAGCACTTTGGG


invisible?    
Gene introns: 0  

>27230 157 392     18q11.2    chr18:23578345-23578501 BLAT!
CTCCACATGAGGTGCCAGCCCACCTAGACAGGGTTTGCCAAGACTTTCCTCCTAACCCCC
ATCTGAAGGGCATAAAAAGAGTAAAATTAAAGTCATATCAAAATGGGAATTTCTCTGAAG
AGTTTTCAGGGGCTGTGTATGATAACTCCATGTGCAT


invisible?    
Gene introns: 0  

>27953 165 392     2q23.3    chr2:152062783-152062620 BLAT!
GGTCACAATTAAAAATCATATATTCAAATTATACAAAAGATAGCATATTCACATGGAAAA
ATTAAAACCTTACAGAAAAGAAAAAAAATAGTAAAATTCTCTTGTTCCTTCTCTCCACTT
TGGCTCAAAAATAGATTTTTGTCTTTTTATAAGTGTGAGAAATGT


invisible?    
Gene introns: 0  

>3849 126 391     17p13.1    chr17:8260560-8260470 BLAT!
ACTCGGGAGGCTGAGGCAGGAGAAAGGCATGAATCCTGGAGTGCAGTGGCGCAGTCATGG
TCTACTTCAGCCTCAAGCTCCTGAGCCTAAGTGATCCTTCCACCTCAGCCTGCCAAGTAG
CTGAGA


invisible?    
Gene introns: 0  

>10265 162 391     4p16.1    chr4:11217244-11217405 BLAT!
ATTTCATTCTGTCTACATGAAAGTGTGTGTGTATGAAGGTAGAAGGTGATTCAGGCTTAT
GATCTCGATGTGGACTATAATTTTCATAAAGCTTTTAAATTGTTTTATTTGAACTAAAGG
AAACACTGAGCTGAAACACATTTCTTTTATATTCAGTTATGG


invisible?    
Gene introns: 0  

>12082 172 391     3p14.2    chr3:59224519-59224690 BLAT!
AGCTGACTGCTCAATGGACCCCAACTTCCTTTTCTTCTGTGCCAACCCCCACTGGCTAAT
GAGCAACCCAGGACTTGCACCCAGTTCCATTCCCCACAAAGGGCCTTCCGGTGGAGCCTC
CTTCTGGCCTCCTCTGCACTTCCACATCTCCCTCTCTTTCCTCCACTGAACT


invisible?    
Gene introns: 0  

>19053 144 391     10p15.1    chr10:3862967-3863110 BLAT!
CAAACTCGCTGAGAAGTTTATATTGGAAGATGCTGAATGTAAGGGCAGAAAGCAATGCTA
TCCCCAGAAGAGATCAGCGCCTGAGCCTGAGAAGTCATCCAGAGGGAGGCAGGGCCCTTC
CTCAGATCCCACGGGGTCTGGGAT


invisible?    
Gene introns: 0  

>2333 106 389     4q22.1    chr4:92306358-92306463 BLAT!
AAAAACATACAATGGAGTATTAAGCATCTGTAAAAAGAATGAGGAAGATATTTATGAAAG
GTATGGGGTGATTTTTCAAAAGATGATAAGTGAAAAAGACAAAGTG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>5553 146 389     8q12.1    chr8:59436554-59436699 BLAT!
AAATCTGAATTCCAGATAAATCATGAATAATCTTTTTAGTTTCAAATAATACAACCCTAC
AAGAGTTTAGAGAACACAATAAGAAATGTTGTATAAAATGACCCAGCACACACACACATA
TAGTAATCAAAGATAAAGCTCTCAAA


invisible?    
Gene introns: 0  

>9222 117 389     19q13.12    chr19:36168797-36168712 BLAT!
ATGGCTATCAGCATGACCGGGAGCGTCCACATCAGGATGGCAAACCCAAACCACGAGATA
CCCCACGTGTAGCTGTCGATGGCGTGGCCGATGTGTTCGAAGCAGCCCTCAATCATG


invisible?    
Gene introns: UPK1A (36157714 - 36169367)  

>9407 152 389     1p35.1    chr1:32890666-32890817 BLAT!
CTACCTCCTCTGGAGACTGGGTTGGGGCCTGCTGCTGGGCTGGAGAAGATTCAGTCTCCT
TGGTAGGCTCTGAGGTTATAATAAGCTCTGCATCCACAGGTTTAACTGTAACAGTGGGCA
AGTTATAATGAGCTTGATCCTCACCAAGAGGG


invisible?    
Gene introns: 0  

>11946 170 389     2p24.2    chr2:17014096-17013954 BLAT!
AGTCCCCCAAAGTCTTAACTCATTTCAGCATTAACTCAAAAGTCCAAGTTCAAAGTCTCA
TCTGAGACAATGCACATCCTTTATGCCTATGAACCTGTAAAATAAAAAGCAAGTTGGTTA
GTTCCTAGATACAGTGGGAGTACTTACTATTGTCATTATTATTACTTGTT


invisible?    
Gene introns: 0  

>5564 193 388     2q31.3    chr2:181638684-181638492 BLAT!
TTCTGTTGGCATGGAAACTAGTAGAAATACACTGGTCAAACATACTCTTTATCAGCTCTC
CCTACATAGAATAAAAATTTTCATTTGCTCTGCGCAGGATCTTTCCAGTTTGGGGCAATA
TACTATTTAGAAGGTTAAGTTGCTCTATATATGTTAAATATTAACAAACAGGTTTTAATA
ATTGATACTTGAA


invisible?    
Gene introns: 0  

>5751 123 388     9q21.31    chr9:84036943-84037065 BLAT!
GCACAGTAAAAATAGTAATGTGTCATGAGTTTAAAAACACAACTTTTGTTTCTTTTTCCC
TTTCAAGTAATGGAAGCATGAACATATCCACTATTCAGCTTTGTTCCTGCAGATGAACAA
TGC


invisible?    
Gene introns: 0  

>24252 161 388     4q12    chr4:55238752-55238909 BLAT!
CGAGGTGGGTGGATCACCTGAGGTCGGGAATTTGAGGCCAGCCTGACCAACATGGTGAAA
CTCCACCTCTACTAAAAATACAAAAATTAGCAGGGTGTGGTGGCATGCACCTGTAATCCC
AGCTACTCGGGAGGCCAGGGCAGGAGAATTGCTTGAATCCA


invisible?    
Gene introns: 0  

Shown 1861-1890 from 3142 sequences on 63 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs