Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1891-1920 from 3142 sequences on 64 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>26355 119 388     10p12.1    chr10:27272645-27272542 BLAT!
AAAAGTACGCGGGGGCAGTGAAAAGAGTGGGTGATAACCACACCCAAAGTATCTGCCCAT
TTTCAAAATGGGGTAATGCAAATTTGGGATGGGTTGATCTGTCTTACCCTTTCATTTGG


invisible?    
Gene introns: 0  

>27015 122 388     6q22.31    chr6:120951843-120951964 BLAT!
AATTATAAGCCAATGAACAAGGATGAACATAGCAAAAATTGTAAGGAAAATACTAGCAAG
CCAAAGTCAACAGCACATTAAAATAATTATAACCAATTTATCATTGGCATGTAAGGATAG
TT


invisible?    
Gene introns: 0  

>7847 190 387     12q24.23    chr12:119128320-119128131 BLAT!
ACTGAATAGTATTCAACAATAAAAAGAAATTAACCATTGATACATGCAATAACATGGATG
AACATGGAAAACACTAAGAAAAATAAGCCAGATGCAAAGGACCACATATTATATGATTCC
ATTTGTATGAAATGTCCAGAACAGGCAAATCTTTAGAGATGAAGGTAGATTAGTCGTTGC
CTAGGACTGG


invisible?    
Gene introns: 0  

>21506 144 387     21q11.2    chr21:15060175-15060318 BLAT!
GAGGCTGAGGAGAGAGGATCACTTGAGTCCAGAAGTTCAATACCAGCCTAGGTGACATGG
CAAAACCCCATCTTTACAAAACAAAACAAAATAGAAAAAATATTCAGGCACAGTGGCATG
TGCTTGTATTCCCAGTTACTCAGG


invisible?    
Gene introns: 0  

>27476 118 387     9p24.1    chr9:7597225-7597108 BLAT!
TACAGGCACGCACCACTACGCCAGGCTAATTTTTGTATTTTTAGTAGAACCGGAGTTTTA
CCATGTTGCAGGCTGGTCTCGGACTCCTGACCTCGTAATCCACCCACCTTGGACTCCC


invisible?    
Gene introns: 0  

>3398 172 386     13q12.3    chr13:30744966-30745137 BLAT!
CATTCCTTCTGACTGGTATAGCCTCTCTGCCTCCCCTTCTCTACTGATTCCCGTCCATCT
TTTGAGACAGCCCCTCTGCAGGAAATTTCCCTGCACCCTCCTGACTGTGTGAGGTGTCTC
TCCCGGGGGCACCCACACCACGTGCCTATGCTCCTGCAGCACTTCTGACTCT


invisible?    
Gene introns: 0  

>10486 148 386     2q24.3    chr2:168535957-168535815 BLAT!
ACCCTGTCTCTACTAAAAATACAAAAAAAATATTAGCCAGGCATGGTGGCACGTGTCTGT
AGTCCCAGCACTTTGGGAGGCCGAGGTGGGCGGATCACCTAATGTCAGGAATTCAAGACC
AGACTAACCAACATGGAGAAACCCTGTC


invisible?    
Gene introns: 0  

>24176 171 386     13q12.12    chr13:23351755-23351585 BLAT!
TTTGGATATTTCCCCTCACCATGTTGGCTCCTTGTTAAATACACTTGATATTAAAAAGCA
CTGTAGTCATTCTGTTTCCAGTAGTCTATTGTTTATTTAAAATGGAAGGAAACAGGAAAA
CCTGCTGTGAGATATTCAGCATGGGCTTCCCTTATTAAAATTTTGGAGGAA


invisible?    
Gene introns: 0  

>27401 111 385     4p16.1    chr4:11084983-11084873 BLAT!
AATAATTAAGACCGAGTTTTAGAATATTTTAAATCATGCACAAGCATATGTTTCCCTCTC
TTCTGCTATATCTGGAACACAATATGCAGTGGTTTGAGAGGCTGGGGCCTT


invisible?    
Gene introns: 0  

>20486 180 384     4q27    chr4:122923004-122923183 BLAT!
AATTTCCTTTTGGGGAACTACCTCTCTCCCACTGTGTGTGATGCTGGTGGATGGTAGATC
TGGGGACCTCCCTTCAAAGGAGCTGAAGTGACTTGCTCTTTCCTCTCAAAGCCCCAGGAC
AACAAAGGTGTGAATCACTAACCTGTGCTCCATCAGTCAGATGCCCTCTCTTGGGTCTCT


invisible?    
Gene introns: 0  

>20944 121 384     19q12    chr19:29282741-29282630 BLAT!
GATGGATTGAAGACAACCTTGATTTCAGTGTGAATTCAGAGGTGTCTGTGTTTGAAGTCA
ACATTCGATTTATTGGAGGCCTACTTGCAGCATATTACCTATCAGGAGAGGAGATATTCA
A


invisible?    
Gene introns: 0  

>21231 152 384     Xq11.1    chrX:62285864-62286015 BLAT!
CATCTGGTGGGTGTCCCTCTGGGACGAAGCTTCAAGGGGAAGAAACAGGCAGCAATCTTT
GCTGTTCTGCAGCCTCTGCTGGTAACAACCAGGCAAACGGGATCTGGAGTGGACCTCCAG
CAAACTCCAGCAAACCTGCAGCAGAGGGTCCT


invisible?    
Gene introns: 0  

>25920 101 384     12q13.11    chr12:48235066-48235166 BLAT!
GGCCTGCTTTAGGAATGGGAACCTCTTTTATCTCCTCTCTAGGAGAGAGCTAGCAAGACC
ATCAGTCGTCTGTCAGGTCCCCCAACTCAATAGGAAGCAGG


invisible?    
Gene introns: 0  

>6941 154 383     13q31.1    chr13:79256262-79256415 BLAT!
TTCATTTTTTTTAAGGCAACAAAAACAGTCTGTTTTTGATAGGGGAGGAGGAAAGAATGT
AAATACTTGTCTAAGAGTATTGTGGTGAATGGCCTTTGGAAAGCTTTATTGACAAGCTCA
ACCTCAATTATAAATGAAGGGAGAGGCAAAGTGT


invisible?    
Gene introns: 0  

>19902 144 383     10p12.31    chr10:22336005-22335862 BLAT!
ATTTGTTTGTTTGTTTTGTTTTACATTCTTTCCAATCTTTATACATTTTATTTATTTTTC
TTGTCTTACCACAAAGGTTATTCCTGTCACCCAAGATGAAAGAGAAGCAATAATTGAAGC
TATTCTTACCTCATACTTAATTTT


invisible?    
Gene introns: 0  

>6102 166 382     9q21.2    chr9:80909731-80909566 BLAT!
GAGGGAGCCCCAGGTCCCTGAATCACCTGCACCAGACTTGTCATATGTAAGTGAGAAATC
AGCTTCTTTTGTGCTATGTCACTGAAATATGAGAGGCGATTTGTTACAGCAGCTCACATT
ATCCTGATTATTATGCCATCCTTAATGCAACAGCTGAAGTTCAGAT


invisible?    
Gene introns: 0  

>9064 149 382     2q31.3    chr2:181673463-181673611 BLAT!
ACATAATATATTTACACATATCTTATAAATGACAACATGATACTAAACTGCTGGATAAAA
TTTGAAAGAAACAATAAATGAATCAGATATTCTGTTAGCATGATAGTGATATCTTTGGAA
AGAATTATTTGAGTATATCTTATTTTAGA


invisible?    
Gene introns: 0  

>17681 180 382     17q11.1    chr17:25265159-25265231 BLAT!
GGTATGGATTGGATTGGAATGGAATGGAATAGAGTGGAATGGATTGGAATGGAGTGGAGT
GGAATGGAGTGGTGTGGAGTGGAGTGGGGTGGAATACAATGGAGTGGAGTGGAAAGGAAT
GCAACGGAATGGGGTGTGGTGGAATGGAATGGAGTGGTGTGGAGTAGATTTGAGTGAAAC


invisible?    
Gene introns: 0  

>9889 124 381     Xq28    chrX:150582117-150581995 BLAT!
CATTCTCTCACAGTTCTAGAGGTCAGAAATCCTAAATCAAGGCATCAAGAGAGCCACACT
CCTCCGAGAGGCTCTGGGGCCTCTTCCTTCCAGCTTTTGGTGGCCCCAGGCTTCCTTGGC
TTTT


invisible?    
Gene introns: 0  

>12169 143 381     Xp22.13    chrX:17535084-17534942 BLAT!
AGCCCCATATGCTTCTGAGTTGAGCTGATGTCTTTCATCAAACTTGATGCCATTATGACA
CAAATGTGGGAGCTTTGTTTGAGTTCTGGGCTAGCCATGCAACAAGCTTTTGCTTTTAAG
GCTGTAGATCCATATATTCCCAT


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>18991 123 381     11q14.3    chr11:90831226-90831348 BLAT!
AAAGTAGGCAAATATCTAATATATTTCAACATTGAATTATTCCAATAATGCAATTTGGGA
TACTGCAGACCCATTTTAACCATTTCAAGTCAAACTCCCTCTTTAAGAAGAAATATTGGG
TAT


invisible?    
Gene introns: 0  

>22124 107 381     4q31.21    chr4:145541249-145541143 BLAT!
CTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAAGCTCCGCCTCCTGGGTTCACGCCAT
TATCCTGTCTCAGCCTCCTGAGTAGCTGGGACTACAGGCGCCCACCA


invisible?    
Gene introns: 0  

>27821 115 381     6q21    chr6:113910970-113911073 BLAT!
CAGGAATTCGAGACCAGCCTGGGCAACATGGTGAAACCCCAACTCTACTAAAAATACAAA
AATTAGCCGTGCCTGGTGTCATCCACCTGTAATCCCAGCTACATGGGAGGCTGAG


invisible?    
Gene introns: 0  

>29000 208 381     11q13.3    chr11:68813998-68814205 BLAT!
ATTATTCAGCTTTAAAAAGGAAGGAAATTTGGACACATGCTACATGGATGAACCTTGAGG
ATTTTAGGCTAAATGACATAAGCCAGTCACAAAAGAACAAATACTGCAGGATTCCACTTA
AATGAGGAACCTAGAGTCGCCAAAATCTTAGGGATAGAAAGGAGAATGGTGGTTTCCAGG
GGCTGAGGGAATGAGGAGTCAGTGCTTA


invisible?    
Gene introns: 0  

>1804 113 380     2p16.3    chr2:52825648-52825727 BLAT!
TACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTTTGGGAGGCCTAGGCGGGGAGA
TCACCTGAGGTCAGGAGTTCAACACCAGCCTGGCCAACATGGTGAAACCCCAT


invisible?    
Gene introns: 0  

>1987 119 380     7p21.2    chr7:15915598-15915715 BLAT!
TTTTTTTTTTTTTTTTTTTTTTGAGATGGAGTCTTGCTCTGTCACCAGGCTGGAGTGTAG
TGGCGTGATCTCAGCTCACCGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCCT


invisible?    
Gene introns: 0  

>9293 170 380     2q31.3    chr2:181725735-181725566 BLAT!
TTCATTAGGATTTTATAAACAAATTGTGTGATATTGCCAATGTTGTTAATCAAACAACTT
TAACACTAGGATTTTAACCTAATATTTAAGGCAGTCCCTGCAGAGAGTATGCAGTGGTTC
TTATGCGTTAGTGTGCAGATTAATTTTTGGACAAGGCTGCTACAAATGAA


invisible?    
Gene introns: 0  

>10682 161 380     11p15.1    chr11:18137951-18138111 BLAT!
GGAATTATGCCTCTTTCTGGGTTCTGGGCATATTTTAGGCACAGTAAAATGAAAGTTATA
AGGCAGATAGCTGTCAGAGGATTTCCCTGTCCCTTTGGTTCTTATCTAAGGCAATGCTAA
GCAACATTTGAATATTCCCTACACAACTTCCATTCCTTGGA


invisible?    
Gene introns: 0  

>23533 187 380     6q16.3    chr6:101140787-101140601 BLAT!
AAAAAAGTATTTCAAAGATGGTATTTAATAGATCATCATTATGTTGATCTTGTCATTAAA
TCTTCTAAAGCATCATCAAGTTCTCCTAGTCCAACTGCTTATTTACAGATGAGAAAACTA
AGCCTAATACTATGCCCAAAGTGAAATATGCTTATGCTTTGGAATTGAGAATAGAACCTT
GGCTTTT


invisible?    
Gene introns: ASCC3 (100956607 - 101329224)  

>29476 120 380     14q21.2    chr14:47106324-47106443 BLAT!
GCTGCACTTGAGGAACCTAGGTATACCTGGTGTGCTGGCAACAACACTCCAACAGGCAGT
GCCGGCAAAAGCACTTTGTCAGAGCAGTGACAGTGGCATCTGCAGTGTGTGCTGGCAGGG


invisible?    
Gene introns: 0  

Shown 1891-1920 from 3142 sequences on 64 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs