Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1951-1980 from 3142 sequences on 66 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>26589 154 371     4q13.2    chr4:67986855-67986702 BLAT!
AGATGGATAGCTGTGGAGATGACAAGAATACAGGCAATTCAAGTTTTTCATTTCCTTTGT
AGCTGGAGTTTTAATAGTTCTCTAAATCTGTATTTATGTTCTCATCAAAACCCCTTTTAA
AAGAAAGCAGATAGTAGTCTTCCTATCTCATTCC


invisible?    
Gene introns: 0  

>31784 140 371     16p12.1    chr16:24393285-24393424 BLAT!
ATGCCTAGGCATATTCAGACAAGATGGGGCACAGCAAAGGCAAGGGGGTATTTGGAATTA
TAGGATAGAGAACGGGGAAACTGGATAAGTTGTTTGAAGAGGGGACCTAACTGTATCTAA
CATTCCTCAAGAAGTTGGAG


invisible?    
Gene introns: 0  

>18892 126 370     3q25.2    chr3:153028005-153028130 BLAT!
CATTTGTTTTTTATTTTGAAATCATCCTAGTTTTAATTCTTGGTAAAAATTTCTCAGGTT
TTCATTAGAGGACAAAGCATTGGTTATAGAATCTGAATGGGGCCTTACCAACCTTATAAA
TTTTTT


invisible?    
Gene introns: 0  

>32106 140 370     13q34    chr13:111589918-111589780 BLAT!
TTGCTGCTTGTTGAAGATGAGTAGCTCCTTCAGGTCATTAGTTGAACACACTTTCTTTAG
CTCGTCCTTGATGTTCCAGATCAGGTCGTTCTGAGCCTTTAGGGCTTTTTCAAGCTTACT
ATCCTTGTCTTTTTCTTTTT


invisible?    
Gene introns: 0  

>2548 154 369     7p21.1    chr7:19359023-19359176 BLAT!
TGTGCTGAGATGTGTTAATGCAGTAGGCACTCATAAGTGTAAACTGGCTGTGATAGACAG
ACCTTTGCACCCTTGCTGTTCTCAAGGAGGGAATGTCTTACTAGCCCGTTATTATGCTAA
CCCAAAGGTATGGATCATCAGAGACCATTTTGCT


invisible?    
Gene introns: 0  

>4030 173 369     14q23.3    chr14:66523854-66524026 BLAT!
TCAAAACATTTACTAACTAGTGGCAGACTCTGCAAAACAGACTGAGGCCCCAGCAATGAC
CTGTCTGTCCTCCAGAAGCTCCCAGTCTTGCAGGGCCACTGAGCCTAAAGCCAGGATAGG
GAGAGCCCAGGAGCTATGAGAGCCCTGGGGAGGGCTTCCTGGAGGAAGTGCAG


invisible?    
Gene introns: 0  

>5674 135 369     21q21.3    chr21:29279729-29279595 BLAT!
TCTTTTTAATTCAATAAGTATTTAAAATTAGCTTCTGCATGTAGAAACAAAACACAATTA
TTCTTAAAAACAATCATCTAACAAGCAAATCTCCATTTTTAGTTAAGTTGAGCTTTCTTC
TTTAATAACAAAAAA


invisible?    
Gene introns: 0  

>19006 156 369     7q31.33    chr7:125999223-125999378 BLAT!
CTTAGATTTACAGCTGGAGCACAAGTATTATTCTCAATGGCTTGGCAAGTTCTAGTATCT
AGCCAGCTGCATCTCCCACAGATCTACTGGACCTTAATGGAGACTTTCTGGGAGTTCCAA
TTTCCACAATGAGGCAGCAACTGGAGAAATCAGTTT


invisible?    
Gene introns: 0  

>22314 153 369     11p12    chr11:39129616-39129768 BLAT!
CCACTTTATAGCAAGGGTTATCTTTCAGCCAGTGTCCAGTAACACGTTTCTTTTATTTTA
CTGAGACTATACCAGAAGCACCTTTAACATTGATATTTACACCAACATTCTGTTGATGAT
GTAAGCAATTATCTAAAACAAAAGAAGAGCTAT


invisible?    
Gene introns: 0  

>3311 163 367     Xq22.1    chrX:100903542-100903704 BLAT!
TGTATACATATGTAACTAACCTGCACATTGTGCACATGTATCCTAAAACTTAAAGTATAA
TAAAAAAAATTTCAAATACATGGTTTTTAAAACATATTACCTCGTTATGTATTTCTATCC
TAATTGCATTTTGGTCAAATAAAGTGATTATTATGACACTGAT


invisible?    
Gene introns: 0  

>7548 152 367     4p15.1    chr4:35343325-35343476 BLAT!
GATTAGTGCCACCATCAAAGATGCAGGGGTGGTGATTTCTACCATATCCATGTTTAACTC
TCCCATTTGGGTTGTGCAGAAGACAGATGGATCTTGGGAATTACAGTGGATTACTGACAG
CTTAACCAAGTGGTGACTCCAATTGCAGCTGG


invisible?    
Gene introns: 0  

>7795 160 367     11p13    chr11:34872785-34872944 BLAT!
GATAAATTTAGTCTGTGATGTTTCCCCAAGATTTTGAACATGAAACCCCATGGAATAAAT
GCTCAAGGAACATACTTTAGAAAAATAAGAGCTTTACAGCAATATTAGCTTTCAGTGGTT
CCCAAGTAGTTTGAGATAATTCTGCAGTGATACCATCCAT


invisible?    
Gene introns: 0  

>23973 167 367     1q31.2    chr1:190897045-190897211 BLAT!
TAAACCAAAGATACTGTGAAAAAAATGTTCTAGAGCATTGAGATGTAAGATCACAGAACT
CGTATTTTAAAAGTTGATTGGCCATACTTCCTTTTTAAATGTGAAATAACTATTCTAACA
TACACAAGGAGGACAGTTAGGGAATTTTTTAAAAAATCATCTCTAAA


invisible?    
Gene introns: 0  

>30975 134 367     7q36.1    chr7:152580522-152580396 BLAT!
AGCCTGGCCAACATAGTGAAACCCCGTCTCTACTAAAAAAAAGAAATACAAAAATCAGCC
GGGCATGGTGGCGTGCACTTGTAGTCCCAGCTACTCGGGTGGCTGAGGCATGAGAATTGC
TGGAACCCGGGAGG


invisible?    
Gene introns: 0  

>3287 167 366     13q12.11    chr13:20829109-20829275 BLAT!
GACCCAGTTCTCCCAGGTATGATGTTAGTCTCCATTTGATTGATCTATAGATGTTATGTC
CTGTGTTTAATAGTGACTGTTAGAAATATGGTCTAGACTCCATTAGCTGCAATCAATGCC
TACTTACAACTCATAGACACATTTCAGCTGTATATTCAGCCATGACT


invisible?    
Gene introns: 0  

>8287 174 366     17p11.2    chr17:21233888-21234058 BLAT!
CCGGGGCTCTCAAAGTCACTATGAATCTTGACATGTCTGCACAGGCTCTAGGTGCGAAGG
ATGCCCGTGGTATCCACCGGAGTATACTGGGGGGTGTGGAGAAGGGTAAGTAACTTATCA
TTTTAGTCGAGAAGGCCCTGGACAAGAGGACCCTCACAGACATAGACCTGCACA


invisible?    
Gene introns: 0  

>23364 154 366     5p15.2    chr5:10269298-10269145 BLAT!
AGCCGGTGCCTGGGAAGGGCAGTCTCCCAATAGATAGAAAACACCTGAAACTGGTGATGA
GCAGCTTCCTGACAACATCTCAGGAGTTGGACAGGTGGGCTCAAGCATGCGCATTAAGAG
GCAAAATGGCGTCATCTAACTGGAATGCTAGACT


invisible?    
Gene introns: 0  

>6732 156 365     20q13.2    chr20:52315854-52316009 BLAT!
TCACTCTTTTCAGTTGCTGAAATTACAGGTGTGAGCCACCGTGCCCAGGGAGCATTTCCA
CACATAAAGGAACAATCTGGGACTGTCAGTTAACCTCCTGAACTAATAGGGTGACCACGT
GGTTCCAGTTGGTCTGGGGCTTTCCTGGTTTTAGCA


invisible?    
Gene introns: 0  

>11237 151 365     12q13.11    chr12:47953295-47953145 BLAT!
GTGGGGTTTTTGAAAATGTAGAGAGAAGGTGCAGAGCCCAGTCCACAGTGAAGTTGTGCC
TAAGAAGCACTATGCTGCTTTGAATGATAAAATAAAAGGATGTCTTTACAGGGTGGAGAT
TGGTATAAGCCTGGACTCACTGATAATCTTC


invisible?    
Gene introns: 0  

>25666 130 365     8q21.11    chr8:77314215-77314086 BLAT!
AAATTCACAATTTAGGGTCCTGTCAGCAGCTCTAGGGTCTTTTGTTAGGTGCACTTAAAA
TGCCAGATTAAATATTAATATGTGGTTAGAATTGTGCTATTTTGCAAGATCTGAAACCCT
ATTAGTAAAT


invisible?    
Gene introns: 0  

>29021 114 365     15q14    chr15:35606037-35605924 BLAT!
TTCATAGTTTCAGGTCTTAGATTTAAGTCTTAAGTCAATTTCGATTCAATTTTTGTGTAT
GAATAGCCCTGTGCACACACAACATGATCTTTTTTAGAAAAACCTAAAGATGCC


invisible?    
Gene introns: 0  

>6992 128 364     Xq12    chrX:67686304-67686177 BLAT!
TTTCATGATCTTAACACTTTTAAAGATTACAGGATCAATCCACAATTTGGATCTTCTAAT
TTTCTTCATGATTAGGTGAAAATTATGCATCTTTGGCAAGTTAATCAGAAATGATGTTGC
ATTCTTAT


invisible?    
Gene introns: 0  

>16840 114 364     10q25.1    chr10:107766211-107766324 BLAT!
GAAAATATTTTAAGAATTCCCAAAGCACATTTGCATGTTATTTCATTGAATATTTTAAGT
AACTCTGAGTGGTCAGGAAGACATCTATTTATGAAAAATACGAAATCAAGGTCA


invisible?    
Gene introns: 0  

>28686 133 364     1q31.1    chr1:186603693-186603561 BLAT!
AGAATATATTGAATACTCATTATTATTTTTACAGTAATAGTTGCTAGTTATTGACAGAAA
GCCAGGATTCTTAACTAATTTAATGAGCACTTTTTATATTCCAGAGTTTGTGCTAAGTGT
TTTACATGTATTA


invisible?    
Gene introns: 0  

>6967 171 363     9p22.2    chr9:18147873-18147703 BLAT!
TGCAACTGTAGAGAATAGTGGAATACACTGTTCTTGCAAAATATAATGACGTGCTCTGAA
CTGTAAACCACCTATGTTCATTTTCATGCCTACTTATGTGGAACCCTGAAGCTCAATCAA
TGGAATGGAACAGCCTCTAGATAACAGTTTCTACAGTTGCTTTGGTCTTTT


invisible?    
Gene introns: 0  

>8968 142 363     12q14.1    chr12:61331387-61331246 BLAT!
GCAGAAAATGCCATGGCCTTTCAGTCATTCTGGTTTCTATTATTTTATAGAGAGTAGATA
GGAGGGGAGCAGAAGGGAATATTAGAATATTAGACAAGTTAAAAGGCGATAGTTGAGACA
GGCCTTAGATGTTGGAAATTAT


invisible?    
Gene introns: 0  

>9955 179 363     4q35.2    chr4:189630969-189631147 BLAT!
TGTTTGTTTTCATAATAGAAATTTTCAGGTATTGTATGCTGATGAGAATAATCCAGGAAA
GAGGGAAAATATTAAATTTCAGGAGAAGGAGCGATTGCTGGAGCAATTGAGCATTGATGG
TCTCATAGATAACTGAGAAGGTTGACTCAGTATGATAGAGTCATGCTGAACACTCTGGG


invisible?    
Gene introns: 0  

>13507 139 363     3p21.31    chr3:46542965-46543103 BLAT!
GATAATGTAATTAGTATAAATTGTTGATTAACGGGGAACTCACAGCCAATAGCATCATGA
CCCAGGCCTGAAGGAAGCTTCTCTAACACACATATTCTCATATTCTCTCCATAAGGCATA
TCATAGCCTTCTCACTCTT


invisible?    
Gene introns: 0  

>19012 154 363     18q12.3    chr18:43357616-43357463 BLAT!
CACATCCTTTTCTGTCCAGTCATCATGCAATTTCTGCCTCTGCCCCAATCATGTTTCCCC
TAACTACTCTGCCACCCACAGTTTCTCTGTCCACCAAACTCCTAAATCCTTAATGGAATG
ACTCACTTAAGATTGGATTTATTATACACTTATT


invisible?    
Gene introns: 0  

>19585 196 363     14q24.3    chr14:75340775-75340957 BLAT!
GACCAAAAATAATAAAGGGACAGATATGGCTTTTCTAAAGACTGCTTTGGAAATGGCAAG
AACAGCAGTATATTCCTTACACAAATCCTCAACTAGAGAACATGTCCAAAAGAAAGCTGC
AGAATGGAAAATCAAGATAGATATTATAGCAGAACTTCGATATGACCTGCCAGCATCATA
CAAGTTTCACAAAAAG


invisible?    
Gene introns: 0  

Shown 1951-1980 from 3142 sequences on 66 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs