Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1981-2010 from 3142 sequences on 67 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>7136 135 362     6p22.3    chr6:16171813-16171947 BLAT!
ACTTGATAAGCATCTTGAAACACCATGGCTGTAGCTGCAGTAAAATGGGTGATGTCAAAG
AGAACTATCTTGAAACATTTATTTCCAGTCCAAAATGGAGCTTTATATTGTGTTTGTCAT
AAATCTACGTATTCT


invisible?    
Gene introns: 0  

>23622 181 362     17q21.1    chr17:38135367-38135547 BLAT!
CCCTCATCCACCAAGAATTCATGACCAACTGCCAGAAGCTTTGTGTTATGCCGCCAGCCT
CCCTGATCCTGAGCACCTTCCAAAGCCTTACTCTATTGCTCATGGATATACTGGGTTGTT
ATCTGCTGACTTGGTTGTTTTCTCCTTGTGATGTAAACTTAATAGAGAGATGAGCTAACA
C


invisible?    
Gene introns: 0  

>32552 140 362     1p31.1    chr1:78620609-78620470 BLAT!
AATTTATAAAAATAATACAATAAAAATCAAGTGTTCTGCTTTACACTTTAAAGTTTGGGA
TAAAATAAATCATTCAAGAATTGTCTTTTTATGATGATAAATTGATGGATTTGGGGGGTT
GTATATGTCTGGGGAATCTT


invisible?    
Gene introns: 0  

>26505 125 361     15q14    chr15:39008419-39008295 BLAT!
TTGGCTACTTTTAGACTCGTGCTGACTGGTGCGTTTTACAATCCTCTTACTAGCTACAGA
GTGCTGATTGGTGCATTTTACAATCCTCTTGTAAGACAGAAAAGTTTTTCAAGTCCCCAC
TCAAC


invisible?    
Gene introns: 0  

>8602 129 360     9q21.12    chr9:72564341-72564213 BLAT!
AAACTAGTAAACAAAGGAAAAGAACCAAGCATTTATTGCACCTTTCCTGTATAAACACAA
TTATTTCAAAGTAAGAAAATAGTTGGTGATTTCTAGCCAATAAATGCTGAAAAATGCATT
TCCCTTTGG


invisible?    
Gene introns: 0  

>16746 119 360     3p26.2    chr3:3814221-3814103 BLAT!
GTGACCACATGATGCTTTGCTTTTAAGAACCTGCAAATGACATGAGATTCATTATTTTTT
CATGTAAAGAGGATGATGGCAAGCTCTGCTGTGTAATACACAACCAGCCTATCACTCTT


invisible?    
Gene introns: 0  

>18139 148 359     Xp11.21    chrX:57084643-57084496 BLAT!
ACCTGGGGGAAGGGACAGCTGTGGGCACAGCTTAAGCAGACTTAAATATTCTGGCCTGCC
TGCTCTGAAGACAGCAGCAGATCTCCCAGCACAGCACTTGAGCTCTGATAAGGGACAGAC
TGCCTCCTCAAGTGGGTTCCTGGCCCCT


invisible?    
Gene introns: 0  

>21059 133 359     10p15.1    chr10:4245502-4245634 BLAT!
TTTTTTGCTTTAATCCTTTGACTTGTAGTAGAAAATTGCTTTTAAGTAAGAAGTTTCCAA
AATAGTTACACTTAAAAATAATGTTCCTTTTATACATTTGTTGTGGAAAGGCACTAAAAA
ATGCAAAATCGTG


invisible?    
Gene introns: 0  

>24119 113 359     7q11.22    chr7:68037998-68038110 BLAT!
AGACTTCTAATCATTCACTGGCTTCTGAGTCCTGCTACTCATTTGTAGCATCCTGATGTC
CCTCCTGAGCCACCCACCTCCAAGACATCGCCACTTGGAGTTCAGTATTGTTG


invisible?    
Gene introns: 0  

>3792 105 358     3p22.1    chr3:39799013-39799117 BLAT!
AGAAGTGGTGTCCAGTAAGCCAAGGTGGCAAGTCTCCGGATAGAGGGGCAACTGTCCAAC
ACTCCCAGTAGCTGGGTGATGCCTGCCAGATAAAGGGGACCAACA


invisible?    
Gene introns: 0  

>15239 148 358     1p32.1    chr1:59061410-59061263 BLAT!
ACTTTCCTTGTTACTACTACCTTGGTTTATAATAGTTGTTAAGAGACAGAACTTGGGAGT
CAGACTTTCTCAGTTTAAATTCCAATTCCACCACTTGCTGCTGTGTGACCTAGAAAAAAA
TTAACTTAATTTTTTCCTGTCTCAGATT


invisible?    
Gene introns: 0  

>19146 142 358     5q23.2    chr5:127197896-127197755 BLAT!
GCAAAGGAATTGCAGGTTTTTGAAATTATAAATATTGCAGTGCAGTTAAGGAATTTGTGG
AGTATAGCAGCTTCCTTTCTTAGCGTAGATATGAAGAAATAGTAATCAAAGTATCAAACT
GCACCAAGTCATTCAATGCTCC


invisible?    
Gene introns: 0  

>27290 143 358     2p23.1    chr2:30608847-30608705 BLAT!
CCCTTGTTAGGAAGTTAATTTTAACAACTTTACATATTTAGCTAGGGCTTTACAGTTTAG
AAGTGCTTTCACGTGCATAATCTTATTTGATTTCCCCAAATTTTCCTTTATAGGAAGCAG
GGAGAACCTTATTAACCCCATTT


invisible?    
Gene introns: 0  

>32615 125 358     7q31.1    chr7:112649115-112648991 BLAT!
ATCCCCTCGTGAGCCCATGCCACCAGGGCCTTGGGTCCCAAGAACAGAGCTGTGCAGATT
CTCAGTAGCCACTTGGCTGCAGACTGCCTAAGACTACCAAGATCCTGGAGGAAGGGGCGG
CTGCC


invisible?    
Gene introns: 0  

>9565 158 357     2p11.2    chr2:83409094-83408937 BLAT!
CTCACTGCCTTCAGGAATGAAGCTGCAGACCTTTGCGATGAGTGTTACAGCTCATAAAGG
CAGTGTGGACCCAAAAGGTGAGCAGCAGCAAGATTTATTGCAAAGAGTGAAAGAACAAAG
CTTCCACAGTGGGGAAGGGGACCCTCGCAGGTTGCCAC


invisible?    
Gene introns: 0  

>25759 194 357     5p13.3    chr5:30315156-30314963 BLAT!
TTTATATGTGTAAAGTAATGAGAATGGAGGCTGTATACTCACTCGAAATTTATAATCTAT
TATTATTTTAGCCAGGTGGAAGATACTTTCAATGTTGAAGTTCTGCTTTTTATAATAGCG
GAGTAACATTTATCACATTAATCCTACTGCAAATAACTGTTGTAAACTCCAGACAAATTA
TAATGAATAACAGA


invisible?    
Gene introns: 0  

>26279 130 357     5q22.3    chr5:114198619-114198490 BLAT!
AACCAAACCCAAACCCAGCAGAAGAAAGGAAATAACAAAGATCAGAGCAGAAATAAATGA
AATGGAAACAAAAACAATACAAAAGATAAGTGAAACAAAAAGCTAGTTCTTTGAAAAGTA
AATGAAATTG


invisible?    
Gene introns: 0  

>3331 182 356     3p26.3    chr3:1834381-1834200 BLAT!
TTACTAGAGTAAATTATTTCCTAATCCAGAAAATCGACAGTTTCTAATATGGTGCTGTGT
CAACAGCATGTGAACAAGCAGGGATAAGACTCCACATCTCTTATCAAGAGGTCAAGAGGG
AGCTCAGAACTCTGCAAATCTTGGCAAATTTCTTACACTTTCCCATTTTAACCCCTCCCC
CA


invisible?    
Gene introns: 0  

>6614 170 356     7q11.21    chr7:63084801-63084970 BLAT!
CCCCCCCTTGGCTGTTTCCCTTCTCCAACCTCACCTCCCTTCTCCCCACTGCCCCTGTTC
CCACAACAGTGGCCCTCCTTCTGTTCTTGAATTAAATGAGCTGTTTCCAGACTCAGCACT
TTGCACTGGCTGTTCCCTATGCTGGGAACACCCTTCCCACTAACATTTCC


invisible?    
Gene introns: 0  

>11103 101 356     18q21.33    chr18:59166863-59166763 BLAT!
GGTTGCTTTATAATTGGTGAGCTTCTCCTCTCATGCTCTCCTGTTCTGAATATATGTGTA
TCTACATGTGTGTGTGCATGTGCATATGTGTGTGTGTGTGT


invisible?    
Gene introns: CDH20 (59157774 - 59222365)  

>33207 137 356     5q21.2    chr5:102930913-102931049 BLAT!
TCTTATAAGGACCATTTTGATTATATTGGGCTGACCCAGGTAATTCAGGAAACTCTCCCA
TTTTCAAGACCCTTAATCACATCTGCAAATTCCCTTTTGCCATGTAAGGTAACATATTCA
CAGATTTGGGGATTCAG


invisible?    
Gene introns: 0  

>10223 173 355     8p22    chr8:14934625-14934453 BLAT!
TCCACTTCATTACAGCAGTGAGTCTCCAACAAGAATATTCCAAACAAGTCATCTAACATT
TCAAGTTGTTCAAATCATTTTCCTTTTGGCTTCGTAACTTAAAACCCTATTTGAGACACG
CTGCAATTATGTAGAAAAGCGCAACTTGTCAAATCTCATAGCTTTTAAAGTCC


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>11849 116 355     9p13.1    chr9:39836776-39836661 BLAT!
CTGAGCTATTTACTGTGTCTGTAATTTTTCATTTTCCAGAATGCCATGTAGTTGGAATCA
TACAGAAATTAGTTCGTTAGACCTCGAACTTCGTTCTTCTCCTTCAATATTATGTT


invisible?    
Gene introns: 0  

>8728 147 354     10q21.1    chr10:58953127-58953273 BLAT!
CCCTCACACATGTGCCAAACTTAGATACAACTTATTCCAAATATTCCCACTAAATTTTAT
GCAATTCTCAAAATACTCACCCACTCCAGCTCCCTCCAAACCTTAAAGTAATATGGCAAA
TACATATCTCACATATTGGTGTTGAGA


invisible?    
Gene introns: 0  

>11939 138 354     4p15.1    chr4:29717800-29717937 BLAT!
AGTATTGTCCTCTACCTATTTACTCAAAGAGGTGGAGAAAAAGACAGATGGGTATGTGAG
GAAAAAACATTTTTAAGCAGTTATATGAAACGTCATTGTAAGACTAACTTTTTATACTGG
ACCATGGAAAATTTGGTC


invisible?    
Gene introns: 0  

>16839 163 354     4q28.3    chr4:133431055-133431217 BLAT!
TCCACTCTTCTTTCCCTAGTAAAACCTAACTTTTTCTTTTATTCTCCAGACACATTGGAG
GCCACTTGCTCTGTATGTATATCCCAAATAACAATCCTATTTCTTGTATATTATTCCCAA
AGAAAACATTTTTACTTAGAGATTCATATTCATTTTTTATGCT


invisible?    
Gene introns: 0  

>21116 193 354     8p22    chr8:15041852-15041660 BLAT!
ATGATACTTGCATGTTCGTGTCCTAACTACAACTAACATGCACCGTGTTTGTTTTAAATA
TAATTGAAAATTTTAAAAGCATAAGGTAATTATTATGAAATACATTTTGGTTTCCTACCA
GAAGTTCTACTAGTGACAGTATATATGATGAAGAATTTATAATTACAATTCATTTTTATG
AGCAAGCATATTA


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>24260 166 354     7q31.31    chr7:118445755-118445590 BLAT!
TCCTCAAACCAATTAAATTGTTCCCTACCGCATTCCAAAGAAAGGCAATGTTTACTTACT
AACTTCCGCAATCTACATGATCTGTTCCATTTAATTTTCTATCACTGTTACTCATTGAGC
TCAAGCCATGTGACGCTTATCAAACACTTTAGGGATTTTTTGCATC


invisible?    
Gene introns: 0  

>12962 161 353     1p36.33    chr1:47401-47561 BLAT!
TAAAAGAATATCTTGACACACATTAAGCTCACTGACCCCCACACCATGAATGAGGGCATC
TTCAACAATGGTGGATGACGTCTTAGTTTCCCTCAACTCAGTTAATCTAAGTAAGCTCAT
GGTATCACTTTCCTGTCCTAGAGGGAACATATTTCCTGCAT


invisible?    
Gene introns: 0  

>19569 143 353     8q24.3    chr8:139950445-139950587 BLAT!
ATTGGTAGTGCTATTTAGCACCTGGTTACTAGTGCTCATAACTTCTTTATCAAAAGCATT
GTGTAAGGAAGATGTGAGAGATGTATTTGGGAGCTCAGGCCAGAAATGGTCAGGGCTTTC
TCTGTGTGTGGCACAGAAAGTCC


invisible?    
Gene introns: 0  

Shown 1981-2010 from 3142 sequences on 67 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs