Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2011-2040 from 3142 sequences on 68 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>23809 141 353     2p25.1    chr2:9153075-9153215 BLAT!
TATCAACATGGCCAGGTGCACAGAGTGATCTATTAGTTCTGTGTTTTTCTGGGTATCCTG
GACCCCTGTGTTCTTCTGCTTCACTCTGTCCTGGCCACTCTTAAGCCCTAAAGCAAGCCT
GCAGCCAAGGATTTTCCTTTG


invisible?    
Gene introns: 0  

>5473 108 352     Un_gl0002250    chrUn_gl000225:67574-67467 BLAT!
TGTCCCCTGTAGGCAAAGCCTAGGCAAGAGTTGCATCACATGGGTGATCATTGAAGATAT
ATGTCACAATGTCCCCTGTAGGCAAAGCCTAGGCAAGAGTTGCATCAC


invisible?    
Gene introns: 0  

>13970 135 352     16q21    chr16:63053737-63053603 BLAT!
CTTCCCTATCATCCATGAAATGTTGCACCTGGCATTCACTACCTATGCTAATTTTACCCT
ACATTATATTGCCAACCTCATTCTTACTATTTTCCAAGAAGTCTTGCTTAAATGTCATAT
TTTCCTGTGCTTTCC


invisible?    
Gene introns: 0  

>16853 123 352     5p14.3    chr5:18811814-18811936 BLAT!
GATTCGGCTGTGCCGGTGATGGATGGATAGACTGCTGAGAAACCATTTGAGATTTCTGTG
ATTAGACAGGTCCCAATTCCTATTAGTGAGTGTTGCCTTGCTCTGTTGCAGAGAGGAGGC
AGC


invisible?    
Gene introns: 0  

>29037 112 352     Xq24    chrX:118383025-118383136 BLAT!
TAGCTGAACCATAGAAATGTCTATCCTTGGATCAAGCAGCATTTAAAAGCTTGAGCAGGG
TCAAATACAAATTATTATTTCTCTTGCCAAAGTTGAAAGCATAGGTCAAAAT


invisible?    
Gene introns: 0  

>29878 155 352     13q11    chr13:19388547-19388394 BLAT!
ATTTGCAGCAACATGGATACAGCTGGAATCCACTCTCCTAAGCAAACCAATGCAGAAACA
GAAACCAAGTATCTCATGTTTTCACTCATGTGGAAGCTACACATTGGGTGCACATTGTCA
TAAACATGGGAATAATAGACACTGGGAAATAAGAA


invisible?    
Gene introns: 0  

>32469 134 352     8p12    chr8:36113097-36113230 BLAT!
ACACCCCTATGATTTGACTTAGAACTGATCAGCAGCACCCATTTCCTAGCCCCTGCCCAC
CAGATTATCGATAAAAACCCTAGTCTCTGAGTTCTCAGAGAGGCTGACTTGAGTAATAAC
AAGCTCCTGTCCTT


invisible?    
Gene introns: 0  

>8716 145 351     7p21.3    chr7:12967143-12967287 BLAT!
ATTAAAAGTGCAGGGACAACAAGTTGGACCTCGGCCACAACTTATTAATTTCGTGACCTT
GAGGAAAGTTATTTAACTACACTGTTTAAGTTGCTGTTTCTTTGTATAATAAATTGAAGC
ATAAGATTGTGAGAAGTAAATGTTC


invisible?    
Gene introns: 0  

>9304 173 351     4q28.2    chr4:130454168-130454340 BLAT!
TGGACAATAAGTTATATGCTCACTTTAGCCTGTGTGGTGACCACTATTTTAGATGCTGGA
ACTCAGTGATAAAAAACATAGAGACTCCCTTCTGGAGTCCCTTTGGAGTCCATTTGGAGA
TCACATTACAGTAGGGAGGAAGAAAATAAATAAATGTATTGTGTAATGTAGCA


invisible?    
Gene introns: 0  

>16562 159 351     7p11.2    chr7:57864785-57864627 BLAT!
ATACATTTTCTCCACTTCTAATTGTGAGATATTCTTATTATTCCCATTTTGTAGATGAGG
GATGCACAGGCATAAAGCCTATGTGGAGGCAGAGAGCAGCTAAGTAACCTGACCATGGCC
CAACAGCAAACAAATGATGGGGCCACATGCAAATCCAGG


invisible?    
Gene introns: 0  

>3197 122 350     4p15.2    chr4:26808640-26808519 BLAT!
TGTTATATTAGTTTCCTAGGACTGTGGTAACAACTAGGCGGCTTAAACCTTCTGACATTT
ATTCCCTCACGGTTGCAGGACCAGCCTCCCTCTGAGGCTCTAGGAGACGACCCTTCCTTG
CC


invisible?    
Gene introns: 0  

>28070 134 350     2q22.1    chr2:141698246-141698379 BLAT!
GGCATTTGAATTGATTCCATGTCTTGCTATTGTGAACAGTGCTGCAATGAACATACATGT
GCATGTATCATTATAATAGAATGATTTATAATCCTTTGGGTATATACTCAGTATTGGGAT
TGCAGGGTCAAATG


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>30228 164 350     15q21.2    chr15:51253498-51253335 BLAT!
GTTGTGTCCTTGTCTAGTTTTGGTATCAGGGTAATGCTGGCCATATAAAATGAGTTAGGA
AGAATGTCCTCCTCTTCGATTTTTTTGGACTAGTTTAAGAAGAGTTGGTGCTAGTTCTTC
TTTATAAATTTGCCAGAATTCATTTGTAAAGCCATCTTGTAAGC


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>4533 185 349     18q21.2    chr18:51567401-51567217 BLAT!
TCATCAACTGAATATGTCTTTCTCTCTCCTGGGACCTCTCCTGTAAGTGCATTCCCCTAT
GCCATTTTCAGTCATTAACATTTTAGCTGAAATTACTCCCTCAATCCATCTAATGGGCTC
CTTAGGGCTCACTTACAGATTTCTGATCTTCTTTAACCCTGAGTCAGGAAGACCTGAGCT
CTCCT


invisible?    
Gene introns: 0  

>16610 122 349     5q23.2    chr5:122955622-122955501 BLAT!
TGATTGTAGCAACCAGAAAGTGGGCCCAAACAAAAACTTCTTTATGACTACTAGCTTTTC
AGCAAGAATACTTGCTTGGAGACATGAGGACACTGTGGCAACACCAACAGTTAATTAAAA
AA


invisible?    
Gene introns: 0  

>18019 149 349     8q24.23    chr8:138063756-138063608 BLAT!
CAATTATTGTGGGCTTTCCAAATGTTTAGTTTACAATCATTTGTATTCAATCAATCATCA
TTTTCCAAACTGTTTATTCCAGTTCAGGGTCTCAGGTGACTGGAACCTATTCCAGTAGCT
CAAGGCGGGCACCAACCATGGAAGGACGT


invisible?    
Gene introns: 0  

>18545 141 349     3q13.11    chr3:103273140-103273000 BLAT!
AAGCGTTACAATTATTAGACATATGAATAACTAAGTCATTACAGATGACAGCCAGCACCA
GTGACCAAATATGTATGTCACACTATCATGAATTTTCCAGCCCAACTAAACTTTCAACTA
AATGCAGCTTCCCAGGTAAAA


invisible?    
Gene introns: 0  

>22511 175 349     10q21.3    chr10:64679658-64679832 BLAT!
TTGGTAAGCAAACTACATACCTTTGGTCCAAATCCAGCTCATTGTGAGTCAAATATGGTC
ACACCCATTTATGCATTGTTTGGCTACAGCTGCAGATTGGCGTAGTTGCGACAGAATGTA
TAGCACAAAACTGAAAATATTTAGTATCTGGCCCTTTATAGAAAACATTTGCAGA


invisible?    
Gene introns: 0  

>3488 178 348     3q13.13    chr3:109635493-109635658 BLAT!
ATGTTATAAAACTGATGAACTCACTTACACATTCTTGAACACATTCTTTGGCATCTTTTG
CAATCTTTCCCGTTTGAGGTATGGCATTTTTCATTATCCTAGCCACGTTTGCTATTGGAA
GATATATATCTTGTTCTCTGAAACTTTCTTTTGAACCATTTGTGTCTTCATGATCATT


invisible?    
Gene introns: 0  

>5104 151 348     1p13.2    chr1:114610117-114610269 BLAT!
TGAACACTCATATGGGATACAAATATCTTCAGTTTTTGACCACTCAGAGAGTTCCATCCA
CATATCTGTCCTCCAAATTTCTTTGTCACCGATTTTCCAATTATGCTTCTTCCAAGTCCC
TGACCATCCAGCCAAACCATTGGCTACAACC


invisible?    
Gene introns: 0  

>5483 147 348     8p21.1    chr8:27726275-27726421 BLAT!
CTCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGTGTGTGCCTGTAATCTCAACTGC
TCGGGAGGCTAAGGCATGTGAATCGCTTGAATCCAGGAGGTAGAGGTTGCAGTGAGCTGA
GATTCAGCCACTGCACTCCAGCCTGGA


invisible?    
Gene introns: 0  

>10650 137 348     9q34.2    chr9:136944240-136944105 BLAT!
ATCTTGACCACCAACATCCCATACTGTGAAACAAATGTTCTTATATTCTACTGTTTCCAC
ATTAAAACCAATGGTAGGAATGGTGGTGACTATCTCCCCTAACTTCAGTTTATACAGAAT
GGTTGTCTTGCCAGCAG


invisible?    
Gene introns: 0  

>20736 171 348     10p15.3    chr10:2281739-2281909 BLAT!
AAAATGTCAGAGCGCAGTGAAGCAGAGGTTACCGTATTAATTTTAATTAACAGTGAAAAG
GACCCCACAGCACCTCTGCCTCTGGCCACACCCTCACCCATACACAAAGACAGAATAAAG
GCTCAGATTCTAAGGTGGTCATAAGCTGGTTTCCCCACCTCCCCAGTTCAT


invisible?    
Gene introns: 0  

>24181 168 348     2p14    chr2:66454793-66454626 BLAT!
ACAAATATAATAATAATACAAGAAAACTGACATAAGGTTTGGCACTTTAAAAGTTTTCAT
TTATTTTCTAATTGTATAAGTGGCAACTATACATGTGCTCCTTATTAAAAAATGTTAAAC
TGTATAGATAAGGCAAAAGTCTCCGATGACATCCATCTAATCTCAGTG


invisible?    
Gene introns: 0  

>24836 166 348     4q13.1    chr4:65600053-65599888 BLAT!
TAAAGTTTGTTGTGTAACTATAGCCTTTACAGTAAAATTTGCTATACAGCCTACCACGAG
GATACATTTCTAATCATTGCTTCTTTTACTTTAAGCCATGGACAAAGGACCTAACAAATG
ATGCCCATTTAGAATAGTAAAGGCCTTCTGGCAATGTTCTCTTTAA


invisible?    
Gene introns: 0  

>29193 157 348     4q13.1    chr4:65098363-65098207 BLAT!
GGCCAACCCCAGGCATGTGCAGATGCAAAATCTCCAGGAGGGAACTTTGCCCCTCTCATT
TAGGCAAAACCGACAGAAGACTTCCTGGCCTCTGCCACATAAAAGACGTAGAACCAAGCA
CCATTTCTGGCAACCTACTTTCAGACAACTTCTCTTT


invisible?    
Gene introns: 0  

>8087 137 347     21q21.3    chr21:27617758-27617894 BLAT!
TGAGATGGGCGGTTGGCACAAGATACAAGTCATAAAGTCCTTGCTGATAAAACAGATTGC
AGTAAAGAAGCTGGCCAAAACCCACCATAACAAAGAAGGCCACATGAGTGACCTCTGGTC
ATTCTCACTACTCATTA


invisible?    
Gene introns: 0  

>10860 149 347     4q13.3    chr4:73121393-73121541 BLAT!
AAGTCAAGAACTGAGGTTTGGGAACCTCCACCTAGATATCAGAAGATGTATGGAAACGTC
AGGATGTCCAGGAAGAAGTTTGCTGCAGCAGCAGGGCTTTCATGGAGAGCCTCTGCTAAG
GCAGTGCAGAAGGAAAATGTGGGGTTGAA


invisible?    
Gene introns: 0  

>12871 161 347     12q22    chr12:95169671-95169511 BLAT!
TCTCTGTGTTTCTCCATGTCTGATCTGAGTGATGAGGTCCCTCCCCTTTCCCTGGAGAGC
GAAGGGATGGGAAGTTAGGGAAGTTGAAGGAGGGAGAGAAGGTGCAGTGATTTACCATTT
GCTTTCTGAACAGTGTTCAAGATAAAACCATACATTGAGAT


invisible?    
Gene introns: 0  

>14392 194 347     9p24.2    chr9:2875798-2875991 BLAT!
GCTGCTGACTAGGACTATAAGCTGGCTGTGTGGGCCCATAGTGAGGTGGGGGCTGAGCAG
TCCCATAGGCACCACCAGGACTGCCTTGGAATTGTCCATGCTCTGGTGTCCCTGCAAAAG
CAGCTGCTGAGCCCACGTAGTGCCGGGTCGTAAGCACTTGGGGTCCAAACATTTGTTTGG
CTCTGTCAGCTGCC


invisible?    
Gene introns: 0  

Shown 2011-2040 from 3142 sequences on 68 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs