Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2041-2070 from 3142 sequences on 69 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>19431 141 347     5q31.3    chr5:144395945-144395805 BLAT!
ATATATGATCCCCAGAACATCAAAATGTGACCTTACTTGGAAAATGAGTCATTGCACATG
TAATTAATTAAAACGGACTAAGGACCATTAGTGTAGGCCTTAATCCCATATGACTGGCTT
CCTTATAAAAAGGGGAAATTT


invisible?    
Gene introns: 0  

>22435 166 347     11q14.3    chr11:92381533-92381626 BLAT!
AGAGCAGATGAATTGCATTGCCATGTTTTAGTTTGGAGGAATGAGGCTTTCTTTGGGGGT
GTGCTGTGCAGGCCCCTCCAGGACTAAGTCACCAATTCCTCCTGCTTCTGGAAGTTTTGG
CAGTTGATGACTCTCAGCTGATTCCATTATTTATCTCTCTCTTTTT


invisible?    
Gene introns: FAT3 (92085261 - 92629635)  

>22816 117 347     3q26.33    chr3:181780398-181780282 BLAT!
TATTTTATACTATGTCCTAGTAAGTATATTTATGACCAACATTTAAAAACACTCAACAAA
CAGACACATGTGAACTATTTAAATGAGCAGTGCCATAACATGAAAGTAGCTCCCTCT


invisible?    
Gene introns: 0  

>31516 153 347     15q21.3    chr15:58148549-58148397 BLAT!
CAGCCTGATGGCATTTCTTCATCACCTCTCTCCAAAAAGCTTCTGCCATCAATGTCTGGA
TGAAAACTCACCTGAAAAATAAAGTGCTGCAATGTTGAGGGCCCCATATATGTAGGACAG
TGAACACAAATGTGGATGAAGGAGAAAACTTTC


invisible?    
Gene introns: 0  

>32161 155 347     9p11.2    chr9:46998319-46998473 BLAT!
TGTTGGGTCATGTGGTTGATGCCCTTCGTAATGCCATTGATGGAAAGGGTCCATTTGGTT
CCAAGAACCATAGGTGAGTTGGTCTGAAAGCCCCTGGAATCATTCCTCAAATTTCAGTGC
AGGAACCAATGCAGACTGGCATTAAGGCTGTAAAT


invisible?    
Gene introns: 0  

>19184 154 346     4p15.2    chr4:26072543-26072696 BLAT!
GGTGATTTTACTTTGCCACAGTGTCCAAGCACCTGATCAATGATCCTGTCTTGATGAAGA
GGGCAGTGGTGAGCATTTGGGGTGCTGTTGAATTTGTGTGGTGGCTCACACACACTAGGA
CCACATATCCTCCCTCAAAATTTTGGAAATTTTA


invisible?    
Gene introns: 0  

>19447 156 346     1p31.1    chr1:79200978-79201133 BLAT!
TTACAGATAGAGTGATGAAAGACAAAGTTCCTGTATTCTAGTGAGGGTCACAAATAATAA
ATAAGTAAAATTCAACAATAGAACTTCAGGTTATATCCTATCTAAAAAGCAGAGTAATGG
GGAAGAGAGTGATATCTAGTTTGGAGGCATGACCAA


invisible?    
Gene introns: 0  

>20466 161 346     2q34    chr2:214044569-214044409 BLAT!
AAGCCCTGTGCTGACCCTTGACTAATCTCTTTAACCAGGAGAATTCTGTGTATTAAGTTG
GCTTACACCCTGATTCACATGTCCTGTCTATGAACGTATCTCTACTGTAAGGGGGCCTGT
GACTGTGTCAGTCAGATTGGCATCAGCTAATCAGGATTCAT


invisible?    
Gene introns: 0  

>23473 135 346     2q34    chr2:210044136-210044002 BLAT!
GAGGTTTCGAAGGGCACCACAAGCATTCTTCTGAACTTCCAAAACTCTGTGGTCCAGAAG
GTCAACCAGATGCTTGATTCCCCCTAACCTACACACCTCCATCTTCACTTTGTTGTCACC
AAAGCACAGGTGCTG


invisible?    
Gene introns: 0  

>14581 113 345     10q23.33    chr10:94958656-94958768 BLAT!
CTCTTCAGAAAAATCCCAAGAAAATCCCGACATGTGCAACTTCTGCCTGGAGCGGATGAG
TCTGGCGCTGAACACCAAGAGGGAGGGTGATAGACCGCGGAGCCGACTGGCTT


invisible?    
Gene introns: 0  

>18838 152 345     15q21.3    chr15:57117642-57117491 BLAT!
GCAGCTTCTGAACCTAAACAGAGAAGGTGGCCTGGGGCCTGGGTCCCCCAGGCCAAAAGC
CAGGGGTCAATATGAGCAACAAGGGCATCCAAGGAGAATTCTGCACAAGAACCACTGAGC
CTATCAGCTGAGCTGGGGTCAAGTCAGGCTGA


invisible?    
Gene introns: 0  

>22705 146 345     2q37.3    chr2:238014354-238014499 BLAT!
AAAAATGCTGGTGAGAAAGCAGAGAAAAGGGAACTCTTATACACTGTTGGTAGGAATGCA
AACTAGTGCAACCACTGTGGAGAACAGTATAGAGGTCCCTCAAAAAACTAAAATAGAACT
ACCATATGATTCGGCAATTCCACTAC


invisible?    
Gene introns: 0  

>23657 148 345     Un_gl0002400    chrUn_gl000240:4031-3884 BLAT!
TGTTCTGGAATCCTATGTGAGGAACAATCAGACCACATCAGGAATGTTCTGGAATCCTAT
GTGAGGGACAAACATTCAGACCACAGCAGGAGTGTTCTGGAATCCTATGTGAGGGACAAA
CATTTCAAAACCTCGTAGCAGTGTGCTG


invisible?    
Gene introns: 0  

>28079 126 345     9p21.1    chr9:30773989-30774114 BLAT!
TCCACAAGATCATTGATGACACCAATGTCACTTGGCTGCAGCTGAAGACACAGATCGAGG
CTTTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCATGAAGAGGAAGTAAAAGACCTGC
AAGTCC


invisible?    
Gene introns: 0  

>29284 177 345     3p14.1    chr3:65016342-65016519 BLAT!
CAGGGTGGATGCAGGTAGATCAGCCCAAGGGTAAGCTGAGTGCTCAGAAAAGACACCACT
GTGGCATGGCCTAAGGTGATGGCCAAGGAGGTAGACAGAGGTAGGTGGATTCAAGAGAGA
TTTAGTCGGTGAAATCAGTAGAACTTGGTGATGAATAAGGGGGTTAAGGGAGAGATT


invisible?    
Gene introns: 0  

>2442 124 344     13q33.3    chr13:108691659-108691536 BLAT!
TGGCAGCAGTAGTTTCCCTCTCATCCTCCTAACCCGGTGGCCTCTCATTAGTTTTAAAAG
GATGGTTTAGTTTTGGGGAAGGGCTGTTATTATTTAAACTACAGACTAAATTTCTTTCAA
AGTT


invisible?    
Gene introns: 0  

>6837 121 344     1p13.2    chr1:115768314-115768194 BLAT!
CAGATGCTTTACTGGGGCTCTGTCAGCAGTGAGAGGATCCCCATATCTGCTTCCCAAATC
CATGGGCCCAGATAATTGCTTTTCTCCTTTCATTTCCAGCCCTCCAGTCCTCCAGACACA
T


invisible?    
Gene introns: 0  

>9356 146 344     12q15    chr12:68379540-68379395 BLAT!
TTAAGGTCATACTGGAGTATGGAGGACTCCTAATCCAATATGACTGGTGTCCTTACATAA
AGGGTAATGAGGATGCAGACACACATGCAGGAAGAATGCCATGGAAAGATAAAGGCAGTG
ACTGGAGTGATGTGTCTATAAGCCAA


invisible?    
Gene introns: 0  

>13797 120 344     9q31.1    chr9:107748314-107748195 BLAT!
TGGCTGGAAGGCAGCCCAGGAGCTCTAAGGGGATACAAGAGAGGGCACTGCAAGGGGACA
GTGATGTCACCAGGACACCGCGTCCCCCAAAGCCAAGGGAAGCAGTAGCTTAGTGGCTCA


invisible?    
Gene introns: 0  

>22358 165 344     3p21.1    chr3:53185248-53185412 BLAT!
ATTCTCCTGCCTCAGCCTCCTGAGTAGCTGAGATTACAGGCATGCGGCACCACGCCCGGC
TAATTTTTTGTATTTAGTAGAGGTGGGGTTTCACCATGTTGGCCAGGCTGATCTCAGACT
CCTGACCTCAAATGATCTGCCCTCCTCGGCCTCCCAAAGTGCTGG


invisible?    
Gene introns: 0  

>23802 105 344     14q22.2    chr14:54513192-54513088 BLAT!
GCCTCTCTAATGGAGGATGCCAGAGGAGGTGGATTTGCAAATGGGAGTTGGACTAGCCAA
CCGATGGCATCTGCTACCATGTTGTCCAGTGCTCTCAGAAGTCAT


invisible?    
Gene introns: 0  

>20057 168 343     4p16.1    chr4:11217087-11216920 BLAT!
TAATGAAATTAGTGCAATCATTTGCAGGGATAAGTAGTTAATTCTTAGCAACTGACAAAG
ACCAAATCCTTTATCCCTGATATTGTTTGGCTCTGTGTCCCCACCCAAATTTCATCTCAA
ATTGTAATCCCCATGTGTAGAGGGAGGGAACTGGTAGGAGGTGATTGG


invisible?    
Gene introns: 0  

>22072 195 343     11p15.4    chr11:6708175-6707981 BLAT!
TCAGCCCCCAGTCCAAAATAACTAGGCAGCTGCTTGAGCTGGCATCTGAATCCATCACCA
GAGGGGGACTACCAAACCATGGGCAGGTAGCCACATGGGCAATCCTGGACAAGCCCCCAG
ATTTGTAACCACCCAATGAGTTCACCTTGCCCACTGCCTAGACAGAGCCGATTTAACAAG
ACAGGGAAATTGCGA


invisible?    
Gene introns: 0  

>13666 170 342     5q11.2    chr5:54844172-54844003 BLAT!
CAAAGTAGGCTGGGCTTGCGTCCAGGCTAATCTGTGAAGGAGGCTAGCTCATGTTCCTTA
CCTACCCTTTGGGTGTCCACTGGGTCGTGCCCCTGGAGCGGCCTTTACCCTTGAGCCATG
GTGCTCACACATAGGCTTTTGAGCTCCTTGGAGCTATCCAGACCCTGCTC


invisible?    
Gene introns: 0  

>30242 146 342     11q21    chr11:96684891-96685036 BLAT!
AAAAACAAGCAATGGGGAAAGGATTCCCTATTTAATAAATGGTGTTGGGAAAACTGGCTA
GCCATATGTGGAAAACTGAAACTGGACCCCTTCCTTACATCTTATATAAAAATTAACTCA
AGATGGATTAAAGACTTAAATGTAAG


invisible?    
Gene introns: 0  

>31637 130 342     7q36.1    chr7:149783674-149783803 BLAT!
TATTAGGTAGTGGTTCTAGAACCTAAGGAAGAGCTGCACTAGCCAGGGCAATCCTGGGCT
GGGAAGAGCATGATGAGAGAGCCTGGGAGTTGAGGGCACCTCAAGGGCAAAGGGGAGCGA
GGAAAGAAGA


invisible?    
Gene introns: 0  

>19691 112 341     9q21.13    chr9:76112469-76112580 BLAT!
TGCATTTTTTATGATGCTTTATGGAACCAAGATACTCCATTCAACTATTTCTCCCCAGGC
TTTTTGTTCATGTATTTCTTTATCCCCTTGATCAACAACATACTTGTTCATT


invisible?    
Gene introns: 0  

>19214 135 340     13q14.3    chr13:54506567-54506433 BLAT!
AGAATCAGATCTGATACCTGGCGGAGAAGAAAAGGCAAAGGTTCCTGCTGAGGGGAGAGT
TTTTATGGTGAGGTGACAGAAAACTGCAGAAGAATGAGTGAGGGGAACATTCTCTTCAAT
TCTGTGAGGAGTTCG


invisible?    
Gene introns: 0  

>24245 140 340     9q22.31    chr9:94474071-94473932 BLAT!
ACACACTCATACACACTGCACACACCCACACCCCCACACACATTCCACACACACCACACA
CACTTACACACCACACACACCTTCAGCACCATACAGACTCATACACACATACACCACACA
CAGACACGTATTCTGCAAAC


invisible?    
Gene introns: 0  

>25660 130 340     1p21.1    chr1:106067460-106067331 BLAT!
GGGTGCTTTCTAACCCATCTAGCCATAAAGTGGGTTGTGCGCAGCAGCATTCCATCATCA
AATGAAAGTAGTATATACATGATTGGTCGCAAGCAGGTGCTGAAGGCACAAGTAAGTTAC
ATGAGAAAGT


invisible?    
Gene introns: 0  

Shown 2041-2070 from 3142 sequences on 69 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs