Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2221-2250 from 3142 sequences on 75 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>24436 125 308     9q33.2    chr9:123040987-123041111 BLAT!
CCCAACACTTTGGGAGGCTGAAGCAGGAGGATTGCTTGAACTTAGGAGTTTGAGACCAGC
CTGGGCAACATGGTGAAATCCTGGCTCTACAAAAAATTAGCTGGGCATGGTGGCGTGTGC
CTGTA


invisible?    
Gene introns: 0  

>26996 125 308     8q24.23    chr8:138064341-138064465 BLAT!
GGTAACGCAGTGGGTCCATAGTAGGTCCATTCTGTGGTTATTTCCCTAGTTTCTCAATGT
GCAGTTGGAATAGAACTATTTAGCAACTGAACGGGATCTCCATTTTCATTCCTTAGCAGG
TTGAG


invisible?    
Gene introns: 0  

>29818 104 308     19p13.3    chr19:248979-248876 BLAT!
ATATTCTGGTTTCCTACCATTATATTTTGGGGTGGCATATTTTGGTCTTATACACTGTGT
TCCACCGGCAATGAAAAGAGTTCTTGTTTTTCCTCCAGCAATTT


invisible?    
Gene introns: 0  

>17926 129 307     1p21.3    chr1:96274107-96273979 BLAT!
AAGAGGGCTCAGAAGAGCCTGACCAAAGTTAGGTTAAGGAGAGAATTGTTTTCAGAACTG
CAGTTCATTCCAGACAGCTTATGCAAAGGGATGGAGAGAATGGGAGATACTGGGAGATGA
GGCTGAAAA


invisible?    
Gene introns: 0  

>23238 126 307     1p34.2    chr1:42218038-42218163 BLAT!
GGACTGAGATGAACCAGGGGCCTAGACCTGGGTCCACCTCCAAAGAGGGGAAAAAGACCA
GGGAAGACTGCGGCTCTGACTGTGATGTGGTCAGCACGGCGATGGAGCTCCCATGGGGCA
CAGGGG


invisible?    
Gene introns: HIVEP3 (41975683 - 42384496)  

>9016 107 306     Un_gl0002250    chrUn_gl000225:16194-16094 BLAT!
GTGATGGAAGTCTTGTCTAGGTTCTGTCTATGGGGGCATTGTGTCAAACACCTGCACTGA
ACAACCAGGTGATGTATCTCTTTTCTAGCCTCTGTTTACAGAGACTT


invisible?    
Gene introns: 0  

>12628 103 306     6q13    chr6:71067868-71067970 BLAT!
CTGGCAGAATTGTGTCCCCCAAAACTTCATATGCTGAAGCCATTAATGTGATGTTATTTG
GAGATATGGCCTTTGGGAGGTGATTAGGTTTAAATGAGTTCAT


invisible?    
Gene introns: 0  

>22185 128 306     19q12    chr19:31274917-31275044 BLAT!
CTGCTGGGGACTAGGGGGGTCCGAAGGAGCCTGTGCTAAGGAAACAAGCTGGTGTTGCTG
GAAACTATGTCTAGATGGTCACAGAGCAGCAGGATGGGGCACTGGGATTCTGCGTGAATG
GCCATCAG


invisible?    
Gene introns: 0  

>29055 108 306     1p21.1    chr1:105489561-105489659 BLAT!
ACAATGTCAGAAGCCAAAGACAAAGAGAGAATCTTGAAAGCAATGAGAAAGAAGCGATTC
ATCATACACAAAAGATCCTTAAGCAGAGCCAGTTTCTCATCAGAAATT


invisible?    
Gene introns: 0  

>29355 165 306     12q24.21    chr12:116149295-116149459 BLAT!
CATCAGAATCACCATCTCCTCCACAACCTCCACCTCCCTCACCAACATCATCATCACCAT
CTCTACCCACCACCACCATAGTATCTCCACCATCACCACCATCCCCACTACACTATGACC
ATCACCATCACCACCACAACCATCATCTCTACCACCATATCACCC


invisible?    
Gene introns: 0  

>3893 147 305     7p14.3    chr7:30203291-30203145 BLAT!
GTGGGGTGGGGAGGGGACATGCCTAGGGCCACAGTCAGCCCAGGAGGAGTCTGGGCTAGA
ACCTTTTGCCCTCAGCCACTGATTTCAGAATGATTACACGGGGGAAATGTGGGTATTTTT
AACACCAGTGCCCGCACTTAAAGGGGC


invisible?    
Gene introns: 0  

>19779 120 305     6q27    chr6:166540592-166540711 BLAT!
ACAGTGATTATCAGAACTTTAAAAATCCAGATGTGCTATTAGAAATGAGGACATACACAA
GAGAACCATCTTGGAAAGAACAAGTGTGCACAGAGACAGGCGTGGGGATGACACTGCACC


invisible?    
Gene introns: 0  

>24738 154 305     5p15.2    chr5:10199201-10199354 BLAT!
ATCTCTCTGTGTGTTGTGGAGCCAGCTTTAGCATGCCAGAGTTACATATGCTGCACTTCT
GTGACTTAAGGAGGCATCTGCCGGCTAGTGTAAAAAGACTTGATGTTTCCATATAGATAA
TTATCCCATGACAGATTCTCTATGCTGTCTACTT


invisible?    
Gene introns: 0  

>26981 128 305     1p21.2    chr1:99868300-99868427 BLAT!
TCAATTTTGTTGATCCTTTCAAAAAACCAGCTCCTGGATTCATTAATTTTTTGAAGAGTT
TTTTGTGTCTCTATTTCCTTCAGTTCTGGTCTGATTTTAGTTATTTCTTGCCTTCTGCTA
GCTTTTGA


invisible?    
Gene introns: 0  

>33072 130 305     Un_gl0002160    chrUn_gl000216:75782-75867 BLAT!
TTCCATTGCATTCCGTTCCATTACATTCCCCTGCACTCGCGTTGATTGCATTCCATTCCA
TTCCATTCCATTCAATTCCTTTCCGTTCCAATCCATTCCATTCCATTCCATTCCGTTCCG
TTCCATTCCA


invisible?    
Gene introns: 0  

>22987 112 304     4q31.1    chr4:139593925-139593814 BLAT!
TCTGCTTTCCTTCTCCCTGACCCCGAAAAACACACGTTTCCTTGCTGTGCCAGCGGGTCT
GTTGACCCTTTCTACAGAGTTGCTTTCTGTTTCGCTGTCCCAGTGGCTAGAA


invisible?    
Gene introns: 0  

>28445 132 304     3p21.31    chr3:46542505-46542374 BLAT!
CTAGCAGTTCATCTAATAGATTTGCCTATTCTGGACCTTTCACATAAATGAAATCATACA
ACATATGACTTTTTGTATCTGATTTTTTTTCTGACTTAGCTTCATGTTTCCAAGGCTCAT
ATAGCAGTTTTT


invisible?    
Gene introns: RTP3 (46539484 - 46542439)  

>3906 135 303     14q32.2    chr14:99540362-99540228 BLAT!
GTGTTTTAAGACACACATAACCCTTGGAAAGGATTTTCATCTTCATGCTTTGCAGAGGAC
ATTAGACGCTCAGAGAGGTTACATAACTTTCTTTGGGTCACACAGCTCACAGGTGACAGG
AGTTGGGTTTGGACT


invisible?    
Gene introns: 0  

>17621 149 303     6q16.1    chr6:94996796-94996944 BLAT!
TAACTCAATATTTAAACCAGTAGCTTTTATAGAAAAATTTAGATTTCCAACTTATCTTGA
AAAATCTGCTAACACCAGATCTGTATTTCCACAGGATAAGAGTTGTCAAGATCTGAGTAA
CAGCGGCTCATTTTGGAAGGGACATAATG


invisible?    
Gene introns: 0  

>30912 100 303     2q37.1    chr2:233560011-233560110 BLAT!
GCACTTTGGGAGGCCGAGGTGGGCGGATCACCTGAGGTCGGGAGTTCAAGACCAGCCTGA
TCAACATGGAGAAACCCCATCTCTACTAAAAATACAAAAT


invisible?    
Gene introns: 0  

>18003 125 302     6p12.3    chr6:51687154-51687030 BLAT!
AAGGAGGATGGTAATTTGGAAATTGCTTGAGAATAAACTATATCCTCTGTGCAGGCTCCC
ACTAATTAAATGCAAAATCTAATGTAACATCTCTTGCTTGTTTTATAGTTTCACACATCT
GGATT


invisible?    
Gene introns: PKHD1 (51480144 - 51952423)  

>18399 144 302     13q33.1    chr13:103752770-103752627 BLAT!
ATCATGGGGGTGGTTTCCCCTATGCTGTTCTCATGATAGTGAGTGAGTTCTCACGAGATC
TGATGGTTTTATAAGTGTTTGCTAGTTCCTCCTGCATTCATTCTCCTTCCTGCCACCTCA
TGACAATGTGCCTTGCTTGCCCTT


invisible?    
Gene introns: 0  

>25296 169 302     Xq21.1    chrX:82809562-82809394 BLAT!
CTGGTGGCATTTCTTTGTTATTGACTGAATGTTTGTGTGCCCCATGCCAGCAAATTCATT
AATTGAAGCCTGATTCCCTAATGTGATGATATTTGGAAAGGAGGTGTTTGGGAGGCAATT
AGAGTTAGATAAGGTTATGAGAATGGTGCCTTCATGATGGGATTAGTGC


invisible?    
Gene introns: 0  

>27591 133 302     4q34.3    chr4:181032080-181032212 BLAT!
AATAATATTTACAAATATATGCCTGTCTGTGCTTTTCTTATCTATTTCCTTTTAGATTCA
GAGGACAAAATCTCCTTCAAAGCCAAGTCAGTCACTCAAACTATTAACACATGCCTCATC
TACTAACTCCAAC


invisible?    
Gene introns: 0  

>9048 127 301     7q11.21    chr7:63383226-63383352 BLAT!
TTCTTCAATAGGTAAATAAATAAACTGGCTGTGGTGCAAGCATACAACAGAACATTATTC
ACTGATTTAAAAAAATGAGCTGTCAAGGCTTGAAAAGACGTGAGGAACCTTAAATACATA
TGGCTGT


invisible?    
Gene introns: 0  

>14493 167 301     12q12    chr12:42012654-42012488 BLAT!
ATTACCTAGTGGAATTTGAGCATTAAATGAGAATGTAAACCTTAGAATGGTGTCTGGATA
AGAGCAAGAGTCCAAAAATTAATTGTCAGCTGTGTAGCTATCCAGAAACTGCCTATTGCA
CAGGCACTTCCTGCCAGGCACAGGTGGACACTGAATATGAGAATGAA


invisible?    
Gene introns: 0  

>16785 129 301     4p11    chr4:48963353-48963481 BLAT!
GTCTGCAGTGAAATTTGAGGGGTTTTATAGATGAGCTTGAGGAGGCGATGTCTGATTTAC
ATAGGGCACGAAATATTGGTTGGACCAGGTGTGCCATTTGCATAAGGCACAAAAAACTGG
TTAGGCCTG


invisible?    
Gene introns: 0  

>2457 112 300     6q12    chr6:64061663-64061774 BLAT!
TAAATATCTTAAATATGAATGTCAAAATAAAACTAACAGCAATCTAATGATCTTGACCAC
TTTGATTTACATGGAGACTAATAATTTTTTAAATGATGTTTCAATGACATAT


invisible?    
Gene introns: 0  

>13606 151 300     16p12.1    chr16:25369555-25369434 BLAT!
CAACATAAAAATGTATGTTTCAGCTGGGCATGGTGGCTCACACCTGTAATCCAAGCACTT
TGGGAGGCTGAGGGGGGCGGATCACAAGGCCAGGAGATCAAGACCATCCTAACTAACACA
GTGAAACCCCATCTCTACTAAAAATACAAAA


invisible?    
Gene introns: 0  

>19808 113 300     4q26    chr4:115855390-115855502 BLAT!
GTGAATAAGTCAGGCCCAGAAAGACAAATACTTCATGATCTCACTTATATGTGAGATCTA
AAAAAGTTGAACTCTTGGGAGGCCGAGGCAGGCAGATCACGAGGTCAGGAGAT


invisible?    
Gene introns: NDST4 (115748926 - 116035032)  

Shown 2221-2250 from 3142 sequences on 75 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs