Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2251-2280 from 3142 sequences on 76 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>20063 155 300     5q13.1    chr5:67457994-67457840 BLAT!
ACAAGGAAAAAGAATTAATCTTGTCTAACCCTGCCCATTCCTGAGTTCCACTACCTAGAG
GAACTACTTTCAACTTTCAGGCTTTTCTGATTTTAAATTCCATTTTTGAAGAAACATGCT
TATATTGCTACTTCTTGATTTAGACATGATTTTCT


invisible?    
Gene introns: 0  

>27928 148 300     6q22.33    chr6:127707221-127707074 BLAT!
AAGCAAAAATAAAAAATAAAAACAAAAACAAAAAACCTGGTTGTATGATAGCAACATATA
TTGCAGCAATACATTTTTGTATATATTGTTTCTATCATGGCCAATTTCCAGTTGCCAATG
TGATGTCAACCAGCTCACAAAACTCCCG


invisible?    
Gene introns: 0  

>32808 138 300     4q28.1    chr4:125935436-125935299 BLAT!
AGCAATATGCTGGGAGGTTGAACTTCCAGGTGAGACCAAGATAGATTGTTTTGGTGCTTT
AATGACAGTGAGTCTTTGATGTCTTTGAGCTATCTGGCTCATAGCCACTTACTTGTGACT
AGCACAGTCAAGAGGCTG


invisible?    
Gene introns: 0  

>6479 144 299     16q12.1    chr16:51795650-51795793 BLAT!
TGCACCTCAGTGTTTCCAGCAATCACATAATGCAACCCCCTTCCCCCCAGTAGCCAGAGA
CACTTTTTCCCGAATGCCTTGAATCTCCTCCTGGCCGCTCTCATGAGTAATTTTTGAGCC
TAATAAAGGAACACCTCCCTCCCC


invisible?    
Gene introns: 0  

>6862 154 299     8q12.3    chr8:64404462-64404615 BLAT!
ACATGTGGGATAGGTCTCTTAATGATAGCAGACAGTTGGATCTTGTCTTTTTATTCAGCT
TTCCCCTCTATTTCTTTTAAGTAAAGGATTTACATTCAGGTTTAGTATTGATATGTGAGT
TTTTGATCCTGTCATCATGTTGTTAGCTGGTTGT


invisible?    
Gene introns: 0  

>15931 127 299     15q23    chr15:70410160-70410286 BLAT!
AAAAGATCTGAACAGAGACCTCACCAAAGAAGGTATATAGATGGCAAATAAGCACGTGAA
ATGATGCTCAACATCATATGTCATTAGAGGATTCCAAACTAAAACAGTGATGAGATACCA
CCCCACA


invisible?    
Gene introns: 0  

>22988 122 299     Xq11.2    chrX:63769456-63769577 BLAT!
CATAGGACCCTCCAAGGCAGGTGGGGGATTTAATCTCCTGGTGTTCCACTTTTTAAGCCC
ATTGAAAAAGTGCAGTATTAGGGTGGGAGTGATGGATTTTGCAGGTGCCATCTGTCACCC
CT


invisible?    
Gene introns: 0  

>26549 116 299     17q22    chr17:54446356-54446471 BLAT!
GCTGCATTCTAATGCATGTATTCGGGTTAGGGGAATGGAAGGAATGCTCAGAAAGGAAAT
ACATTTATTCTAGACTCTGGACCATACACCATCTCCAGCTATTTACGCACACCTTT


invisible?    
Gene introns: ANKFN1 (54230835 - 54560007)  

>27218 116 299     2q35    chr2:219637583-219637698 BLAT!
GTGGAGTCTAGAGGCAGTAGGCCTTGTTGAGCTATGGTGGGCTCTGCCCAGTTCAAGCTT
CCTGGCCGCTTTGTTTACCCACTCAAGCCTCAGCAATGGCGGATGCCCCTTCCCCC


invisible?    
Gene introns: 0  

>30290 119 299     2q33.2    chr2:204100387-204100506 BLAT!
TTTTTTTTTTTTGAGATGGAGTCTCGCTCTGTCGCCCAGCCTGGAGTGCAGTGGCACATC
TCAGCTCACTGCAAGCTCCACCTCCCGGGTTCATGCCATTCTCCTGCCTCAGCCTCCCG


invisible?    
Gene introns: 0  

>8784 112 298     14q12    chr14:30904388-30904277 BLAT!
AAATATCAAAAATTATACTAGAGATGAGTAGTGTGTCCCAGCCAGGAATTTAGGCCAAGA
TAGAATATCTTTTCAAGTGGTCCATTGTATTTTATGTGAGGCTGTTTCCGTG


invisible?    
Gene introns: 0  

>9288 116 298     7q35    chr7:143263118-143263233 BLAT!
TTGCACTAAAGAAGCAAGCCATAAAAGATTACATAAAATATAACTTTCTTGTATTCTTAT
ACAGTTTAAAACAAGTTAAAACTAAACTATGTAGTTTAAGTTTGTGCACATAGGTA


invisible?    
Gene introns: 0  

>10296 151 298     5q35.1    chr5:171730916-171730765 BLAT!
AATTTTGTTCAACTATATTTTACTGAGATATTATCCATTTCATTAGGTTTTCAAATTTCT
TTGCATAGAGGTGTGGTATGGTCTGAATATTTGTGTCCCTCCCCAAATTCTTATGTTGAA
ATTCTAACCCCTGAGGTGATGGTATTAAGAA


invisible?    
Gene introns: 0  

>14885 146 298     3q13.11    chr3:103297759-103297904 BLAT!
ACACACGCACACACACAAAAAATCTATTTAATTTTTATTTAGAATTTAGCCTAAACAAAA
TTATCATACAGGTTTAGATGGTTGTTGGCAACTGAATTACTAAATATTTCCCTAATATTC
CTGGTTCAAGATTAGTCTACCATAAC


invisible?    
Gene introns: 0  

>22536 163 298     Xq28    chrX:152789895-152790057 BLAT!
GAGGGGGTGAGGCTGTGTCCCAATAAAACTTTATTCACAAGAACACTGGGCTGCCAGATT
TGGCACTTAAGCTGTAATTTGCCAAACCTGTTGAATCCAAATGAGATGTGTCTTAGGGGA
TAGTTTGAGGTGAGGATCTAAGGTGCATCCTTTGCAGATTGCT


invisible?    
Gene introns: 0  

>13471 110 297     7q31.1    chr7:108265509-108265618 BLAT!
TATTTCCTACCTAGTTATTACACACCAAAGCTCTCTCATAATGCAAAGTAATTTCTGATA
CCCTCAAAACTCAAAACCATCAGATAACACAATGCAAAACAGAGCAGGGC


invisible?    
Gene introns: 0  

>21324 166 297     1p22.1    chr1:92666177-92666012 BLAT!
ATCAGTTAGGACTAGGTTTGGCTACATGTAAGAGAAAATCCAAATCGATAGTAGTTTAAA
CACACAAAGTTCTGTTCCCTCATGTAACAGCAGTCCAGACATCGGTATCTAGAGTTGCTA
TAGTAGTTTCATGAGGTATTGAGGGACCTAGGCTCCTCTCAGCTTT


invisible?    
Gene introns: 0  

>22208 123 297     18q12.1    chr18:27023614-27023492 BLAT!
TCGAATTTTCCAGTAAATTTTCTTCCTAAATATATTTTTAGAGATTCAAAGCCAAATGAA
AAGCAAGCACAACAGCAAGGGAGAGAGAAATATGGAGAGGAGAGAAAAGAGAAGAGGAAG
ATG


invisible?    
Gene introns: 0  

>22214 146 297     3q25.1    chr3:151932359-151932504 BLAT!
GAATGTATGTGGTGGTGATGCTCATTTTCACTTTCAGAAATCTTGGTGCTCAATTCCTTT
CTTTAAAATTCTGGTAGTTAAATAAGTGCAAAGTAAGACATAATTTTGGCCAGGCACAGT
GGCTCACGCCTGTAATCCCAGCACTT


invisible?    
Gene introns: 0  

>23954 115 297     5q22.3    chr5:114328032-114328146 BLAT!
AAATGGAGTGAAATACCTTATGTCCAAGCTTTCCTTTCATTGAGAGACAATACACAACGA
TGCAAAGCTTGCAATTTACATCCCACAGGAGGACCTTTCAGCTTACCCCCATATC


invisible?    
Gene introns: 0  

>28298 171 297     4q28.3    chr4:138825064-138825234 BLAT!
GGGCAACAAAACAAACAAACAAACAAACAAAAAACTACTTTCAATTTTCCCTTCAGCAAA
GTTGATTTTACTCTCTTGGTCCTTCATTTTAGAAAATGGAATTTGAAAGAGAGAACAAGA
ATAATCCATTAGAATTAATAGTATCCTCTATCACAAACCACTGGAATTAGT


invisible?    
Gene introns: 0  

>32924 162 297     21q21.2    chr21:24069718-24069557 BLAT!
CCCTATCTCTCTCCGTATATAAAAATTAAATCAAAATAGATTAAAGATTTAAATGTAAAA
TCTGAAGCTGTGAAACTATTAGAAGAAAACACAGGAGAAATGCTTTAGGACATTGATTAG
GGGAAGATTTATTGAGCGTAACCTCAAAAGTGCAGGCAAGCA


invisible?    
Gene introns: 0  

>23755 142 296     9q21.12    chr9:73202919-73202778 BLAT!
CAGAGGAGAGTGAGAGAATGTGATTGGAAGCAGAAGATAAGGAACCTGGGGAAGGGACAG
TGACTGTCCGCTCTACCCGGAAACTTTGCCTACCACCTTGATTTAATTCGTGGGAATGCA
ACTTGCTGTTGTTGTGTGGTTG


invisible?    
Gene introns: TRPM3 (73149965 - 73483974)  

>32084 142 296     18q11.2    chr18:23119532-23119391 BLAT!
CTGCCAGGGCATTCTTTTTTATGGATATCAGCGATCATTTAAAAAGCAATCCAAGGGTAT
TGAAGAAGAGATTTCATACTGTAAAAACCTGACAGCCTTTATCATGTAGAATAAAATAGC
AACTATATTTTTTTTCTAATTC


invisible?    
Gene introns: 0  

>13065 151 295     Xp11.21    chrX:57209151-57209001 BLAT!
ACGATTGATATTCCTTTGTATATATACCCAGTAATGGAATTTAGAATGGCAAGTCTATAT
TAAGCTCTTTGAGGAGTTGTGCCGCACTGCTTTCTACAATGGTTGAAATAATTTGCACTC
CCACCAACAGAGGGAAATCATTCCTTTTTCT


invisible?    
Gene introns: 0  

>24039 161 295     21q21.3    chr21:29802582-29802742 BLAT!
ACTTTTAACTGTGCCCAGCCTTTCAGCTTGTAGCCAGGGATAGATGGAAGGCTTTGCACT
CACTCCCAACAAGAAAAGAATCCAGGGGAAAAAATCCAGTTCCGCCCCAGGCAGGCAGAG
TGATGGTCCTGAGCAGAGCAGGCAAATTTTTTCTGTAAAAA


invisible?    
Gene introns: 0  

>32993 133 295     16p12.2    chr16:22657795-22657663 BLAT!
AATAAACATGATAAGTAAAGCATATGGTATGTTAAATGGGAGAGGTGCTAAGAAAAGACA
GAAAAAGCACAGTGGGCAGGGAACTGGAAATCATGCAGGGGTTGCCTACTGATATTTAGA
CACAGTGGTCATA


invisible?    
Gene introns: 0  

>18715 150 294     4q28.1    chr4:125936588-125936737 BLAT!
TTGTTGTGTAGAATAAGAGAAGATGACCCTTCAAAATGATGATTATTTTTATTTTTGCTC
AGCTCATGAGGCACCTGCTTATTGCACTTTTTCACCTTTCCAGTTAGCTTCAAATGCCAA
ATGACCATAGAAAGGTCAATATTGAGATAT


invisible?    
Gene introns: 0  

>18861 120 294     1p35.1    chr1:34044397-34044516 BLAT!
AGCCACCCCTGGTGAGGTCCCCGGCCTCTTTCTTGGTGATCATATCCCTCTGCCGGTGAA
ATGGTTGTTTTAAATAGCTGCCTTCCAAGCCGAATTTGTTTCCCTACTCCTGCTTTGCCC


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)  

>24125 151 294     5q14.1    chr5:79699945-79699795 BLAT!
CAGGCCAGGGATGCCGCTAACTGTCTTGCAATTCACAGGAGAACCCCCAACAACAAAGAA
GTTTTCAGCCTAAAATATCAACAGTGCCAAGGTTGAGAAACCCTGATTTAGCCAGTGAGT
GGTTTAAAGCTAGTATATTTCTTCCAATTCC


invisible?    
Gene introns: 0  

Shown 2251-2280 from 3142 sequences on 76 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs