Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2311-2340 from 3142 sequences on 78 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>17285 122 286     17p13.3    chr17:2493081-2493202 BLAT!
CTAGCACTTTGGGAGGCTGAGGTAGGTGGATTGCTTGAGCTCAGGAGTTCGAGACCAGCC
TGGGCAACATGGTAAAACCCCGTCTCTACTCAAATACAAAAAAAAATTAGCCGGGCGTGA
TA


invisible?    
Gene introns: 0  

>18728 143 286     1p21.2    chr1:101728047-101728189 BLAT!
GATTTCCAACAATTTTAACAATATGCCTGTTATTGTCAGCAGGCTTAAAAACGAATCATA
TGGTTTTCAGAGTTTAGCAGGCAGGCTAACTCCCTAAGAAGAAACTCAGTTTATAGAAGA
CAAAGGGTAGGGTTAAAAAAAAA


invisible?    
Gene introns: 0  

>18877 141 286     2q32.1    chr2:187400984-187400844 BLAT!
GGGACACTCATTTACCTCCTCCATTATGGGCCACTCTTTCTCAATTTCCTTTGTTGGTGT
CCCGTGATGTCCCTAAATGCTAAGTATCAGAGTGCTTCTACCTCAGTCCTTGGTCTTCTT
TTCTCCATCTACACTTACTTT


invisible?    
Gene introns: 0  

>19728 128 286     6p22.3    chr6:23645475-23645602 BLAT!
AATGCATTTTGTAACAAGAAAATGCATTTTGATGGAATGGCAAGTTCCATCAAACGGAAA
ACAAAACTGAAAAGGAAAACTACATTTGCTGCTATTACGTGTATTAAAATCTAAGAATGA
ATCGACAT


invisible?    
Gene introns: 0  

>23315 140 286     4q34.3    chr4:180954799-180954938 BLAT!
CACTAGTGATGTCATTAGTTGTATGTTTCTCCTGAGTTGTTCCTGCCTGTATGTTTCTTA
GTTGTATAGGATCTAACTGTAGTTCTCCGGTTCCTCACTAAATCCTTTTCTGTTCAAGCT
AACTCAAGTAAGTTCTATTA


invisible?    
Gene introns: 0  

>24074 116 286     13q13.1    chr13:32276904-32276789 BLAT!
AGTTAGCAAGAGGGGACTAGAATCCCAAACTCCTAATTCCATAGTTCCATTCTCATTCAA
TGAATAGTTGGATTCCAACTGAAATAGGAGCTTGAATGATACACTTTATAAACCAA


invisible?    
Gene introns: 0  

>27606 109 286     Xp22.2    chrX:11550095-11550203 BLAT!
ATTCTCATTTGAGGAGCTCTGCTCCAAGGATGCTATTGAGGCATTGGTGCTACACTGAGC
TGGGGTTCGAAGTCTCCTTTGTTTTCAACCATGTGGGTGGAGGTTAGAG


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>32710 135 286     2q22.1    chr2:141931419-141931553 BLAT!
ACAAATTTACTTACCTCTTAAGCCAGTTAAAGATGAGATTCATGTTAGTGTCCAAAGTAT
TCTAAAATATACTATATTATACTATGTTTACACTATTTCAACTGACTTCTCCTTCTTTTT
ATTTTAGATAGCATT


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>3951 112 285     1p36.21    chr1:14549680-14549791 BLAT!
AGTCACAGGACAAAGCAAGAAACACCTTTTGGGGCACTGAACACCTGTTATCTTGCTGAA
ACAAAGATGGCAGCCTGAAATGGTTGTTAGCATCAAGTTCTTTTGAAAATGC


invisible?    
Gene introns: 0  

>12975 111 285     2q33.3    chr2:206435357-206435467 BLAT!
CCACAAAGCAGGTTGAATGGCATCAAACTCATCCTCCTCGCTCCCACCCATTGCACCACA
ATGTGAAATACAGAACCTGGTTAAGCTTTAGAGACCAGACGTATGTGTTCA


invisible?    
Gene introns: PARD3B (205410515 - 206480537)  

>22744 102 285     12q15    chr12:68212464-68212363 BLAT!
TTATTTCATCTGTTTTAGCCACAGCCCCACAAGCCTATCCATTTGTCATAGGTGAAGAAA
CTGAGGAAAAGAACCCTGTCTTGAATAACTTGGCCAAGGTCA


invisible?    
Gene introns: 0  

>26862 100 285     12q21.33    chr12:89786012-89786111 BLAT!
ACAGAAAAAAAGCACCGAGCCAGTTTCACAGGCTCCGTTGCTCCAAAGCCATCATTTCAA
GGTTATGGCTTTAAAATTATGGAGGAGGCAGCTTTCACCT


invisible?    
Gene introns: 0  

>32852 135 285     10q26.3    chr10:133278393-133278259 BLAT!
GCCAAAATGTCTAAGTTTTTATTATTTTTAGATTTTTCAGATCCAAAGTAGCTATCATAA
CCCTTCAAAGCAAGTGACGTGTTCTCATTTCACTCCATTCCAATAGCATAAAAGTCTCAG
TAGAGAAAAGACCCT


invisible?    
Gene introns: 0  

>9464 105 284     11q12.1    chr11:56823356-56823460 BLAT!
TTTCTGTAATAAATCCCTAGGGCTTGGTCTTTCATGCTACAACATTTATATCAGCACAGC
AGTCCCTGCCTTTGCGGAGTTTGAGTGCTGCATTCATTGCCATAT


invisible?    
Gene introns: 0  

>10910 170 284     Xq21.2    chrX:84943224-84943055 BLAT!
CTCATTATTGGTCTGTTCAGGATTTTTATTTCTTCCTGGTTCAATTTTGGAAGTTTGCAT
ATTTCCAGAAATTTATCCATTTCCTCTAGGTTTCCTAATTTGTGAGCATAGAGTTGTTCA
TAGTAGAGAAGGCTTAATATTGTTAAAATGTTTATACTACCAGTGTTAGG


invisible?    
Gene introns: 0  

>11990 131 284     16p12.3    chr16:21193838-21193708 BLAT!
AATGAAATAATTATACAACTCACCATAATGTAGAATCAGTGGGAGCCCTGAGCTTGTTTT
CCTACAACTAGACAATCCCAACTGGGGGTGACGGGAGACAGTGACAGATCATCAGGCATT
AGATTCTCATA


invisible?    
Gene introns: 0  

>18874 126 284     11q13.4    chr11:71457871-71457746 BLAT!
CGGGTGTGACTGGAGCAGGGCGTGTTGTCTTCTTCAGGGTCACTCTGCAGGGGTTGTCTG
GGCTTGGTCTTGCCTCCCAGGTTTCAGGCGCTGCAGGTTTTACATGGCTGTGGTGGATCC
AGGCTG


invisible?    
Gene introns: 0  

>30015 156 284     18q21.31    chr18:56099910-56099755 BLAT!
AATGTGAAGTTTACAGAAAAATAAACACATGAAAACATAGTTAACTTCACTCCTAATTAT
GTAAGTGTAGATGAGATATCGATTCTCAGTTAACACATAAGTGAAACTTAGAAGCTTGTT
AATATTTGGTATTGGCCCTGCCGTGGGCAATCTGCC


invisible?    
Gene introns: 0  

>33201 114 284     11q13.2    chr11:66749239-66749352 BLAT!
TCAGCCTGGCCAACATGGTGAAACCCAGTCTCTACTAAACAAATAAAAAAATTAGCCAGG
TGTGGTGGCGAGCACCTGTAATCCCAGCTACTCGGAAGGCTGAGGCAGGAGAAT


invisible?    
Gene introns: 0  

>13512 137 283     Yp11.2    chrY:3000834-3000970 BLAT!
GCCATTTAAATCTTTCTATGAAGCTGAACTCTGGTGATATAATTTAAATTAAAGATAATA
TTAAGGCCTTTCTCAGGTTTTATAGAGCAGTTGAAGTTAGTTTCCAGGTATTTATGGAAA
ATGCTACTAATGAGGGA


invisible?    
Gene introns: 0  

>13531 135 283     1q43    chr1:238309368-238309234 BLAT!
CAACACCGAGGGGGAAATCTGCCCCCAGGATCCAGTCACCTTCCACCATGCCCCACCTTC
AACACCTAGGATTACAATTTGACATGAGATTTGGGCAGGGACGCAGACCCAAACCATATC
ACTAAGTATCCTATT


invisible?    
Gene introns: 0  

>15561 136 283     16q21    chr16:66113103-66112968 BLAT!
GGCAGAAGAAATAATCAGAATAAACAGCCCACAGAATGGGAGAAAATATTGGCAAACTAT
TCATCTGATATAGGACTGATATCCAGAATCTACAAGAGACTTAAATCAGCAAGAAAAAAC
ACCCCAACAAATAATC


invisible?    
Gene introns: 0  

>17828 105 283     2q22.1    chr2:138426336-138426232 BLAT!
TTATAGTAAGAATATACTATATAATTCATATACAAAATATGCGTTATTTGACTATGTTAT
TGGTAAGGCTTCTGATCAAAAGCGGGCCATTAGTAGTCAGGTTTT


invisible?    
Gene introns: THSD7B (137748461 - 138435287)  

>20446 130 283     1q21.2    chr1:147299680-147299551 BLAT!
AACAAAAACAAATTTAAATAGTGGGGACCTAATTAAACTAAAGAGCTTTTGCATGGCAAA
AGGAACAGTCAGCAGAGTAAACGGACAACCCACAGAGTGGGAGAAAATCTTCACACTCTA
TACATCTGAC


invisible?    
Gene introns: 0  

>26393 130 283     17p13.2    chr17:5532761-5532890 BLAT!
AGCTAACGACGCTGACAAAATACATTGAACTGCTGTTCTCTTCCACACATTCAAATAAAA
GGCAGTGTATCTTGATGCAGGGCACATCAGTGGGTGATGGCAAAACATTATTTTTTCTTT
ATGAATAATA


invisible?    
Gene introns: 0  

>8648 159 282     4q25    chr4:111766761-111766603 BLAT!
TTGTGAACATTAACTGTGTTAGTTTATATACAGCACTTAGGAGAGTGCCTAGCATAGAAC
AAGTGTTTTTCATTAACATTGCAATTATTGTTATTAATTAAGAGGGAAATAACAAGGTTG
TATATAACCCATGTGATCTGGAAGCACTGAAAATTGAAC


invisible?    
Gene introns: 0  

>14572 130 282     2q33.3    chr2:206435258-206435129 BLAT!
AAGTTAGACCATAATAAGGTTTCTTGCGAAAACTATTAAATTCACTCTGATATTGAAGAT
ACCCTTCACACAATAAACTACTGTATGGGTATTTTCTTCTCATAAGTTTTTACGAATGAA
ATAATCTCTG


invisible?    
Gene introns: PARD3B (205410515 - 206480537)  

>20640 127 282     7q36.1    chr7:149918550-149918676 BLAT!
CAGGGGACCAAGGGCACGTTAGGATACAGCCATATTATTTGACAAAATGTTAAATTTTAT
CCAGGCAGATATAGTTGAGTTTGAATATTCTGAATGGGAATCAAACCACATAATTTGGTT
TCTATTT


invisible?    
Gene introns: 0  

>25890 100 282     13q33.1    chr13:103880057-103879958 BLAT!
TATATTCTATTAGTTTATTAGACACCATAACAGCTATATATGCCTATTACTATTTAACAT
AAATGAACCATCAACTCTATTGTATTATTCCACTTGTCCC


invisible?    
Gene introns: 0  

>27549 144 282     7q33    chr7:137748336-137748479 BLAT!
TATTGATTGAGAGATAACACTGTCTTTCCCCAGGTTTTGTCATATGAGAATTTTGTTAGC
ACAATATTTTCATTTGTGCAAGACTGAAGTTTCTCAAGATTAAAATTTCCAAAATTCCTT
TCGTTGGTCAAGTAAATATGACAA


invisible?    
Gene introns: 0  

Shown 2311-2340 from 3142 sequences on 78 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs