Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2341-2370 from 3142 sequences on 79 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>30718 108 282     1p21.1    chr1:106014619-106014512 BLAT!
AATTCAGAGTCACAAGCTCTGAGCTATACGTGCTGATTCCAGATCTACATTGCTGCAGAT
CATTGAGTGATGTGTATTCCCATTAAATTAGAGAAGCACTGGGGTAGA


invisible?    
Gene introns: 0  

>8401 140 281     7q33    chr7:137939208-137939293 BLAT!
GAAGGTTTTCTACATTTTTGATGTAGGCACTCATTTTTATAAACTTTCCTATTAGTACCA
TTTTTCCCATAGCCAGGATTCACAGGTCCAGGAATCAAGGGGTGGAAGTGGAAATGGCAC
CATTCACCCTCACCCCTAGT


invisible?    
Gene introns: 0  

>14108 159 281     10q24.2    chr10:100370591-100370749 BLAT!
CTGGTGTGGGAGTTAAGAAGATGTCGACTAGTAATTCACCATTCCTTTCCCTGAAAGCTC
TGTAAATCAAGCTCTTAAAAAAAGCAGCAAGCTAAATTCCAAAACCCTCTCTGAGGAGAA
ATGCCCATGACTGGTGGGGTCTGGACTATGTCCACCAAA


invisible?    
Gene introns: HPSE2 (100216833 - 100995632)  

>14912 143 281     6p22.3    chr6:23972478-23972620 BLAT!
TGCCCTTCCAAAGATTAATAGCCACCCAACCCACTCCCAGAAGAAGGGCTCCCGGAAGAA
ATCCTCTAAGAAGAATCATCCTCAGAAGAATGCGCCACAGAACTCCACCCAAGCTCATTC
TGAGAATAAATGCTCCAGAGCAT


invisible?    
Gene introns: 0  

>21790 146 281     1p36.31    chr1:5875562-5875417 BLAT!
CCACTGGGCATTTCCCTGGCAAGGGAAACAAACTACACTCCCCACGATGGTCAGCTGCTG
AGGCAGGCTTATTAGGAAATGCTCCAGCAGCAAGGGCATCAGGGAAGCAAGAGATCAGCT
TGTTCCCCTTTCCCAGGCTTGGGATA


invisible?    
Gene introns: 0  

>25972 161 281     2q34    chr2:210044947-210045101 BLAT!
CCGAAAAGAAAAGGGGCTCCCCATCCTTGTGGAGCTTCTGAGAATGGATAACGATAGAGT
TGTTTCTTCCGTGGCAACAGCCTTGAGGAATATGGCACTAGATGTTCGCAACAAGGAGCT
CATAGGCAAATACGCCATGCGAGACCTGGTCAACCGGCTCC


invisible?    
Gene introns: 0  

>29165 102 281     14q24.1    chr14:69491523-69491422 BLAT!
GTCAGGAGTTCGAGACCAGCCTGGCCAACATGGCAAAACTCCTTCTCTACAAAAAATACA
AAAATTAGCTGGGTGTGGTGCCATGCGCCTGTAATCCCAGCT


invisible?    
Gene introns: 0  

>31419 145 281     3q26.1    chr3:165460349-165460493 BLAT!
AGCAGAGGCAAAGCCACAATTAGAAAAGATTGACTCATAGACTTCTGGCATTGGCAAGTT
ACTCACAGTGCTCCTAAATAGTGAAATAGATAGAAAACCCATTAAATCCTTACCTGATCT
GTGTAAGCAGCAACCTTTAAGTCAA


invisible?    
Gene introns: 0  

>5886 122 280     2q35    chr2:220728488-220728367 BLAT!
GGATTCATTTGGTTGGTTTGGTTTGGCTTGGTTTTGGTACACCTCTTTTGGCTCCAGTAG
GAGGTTTTGCGAATAGCTGATAGCAAATGGATGGATGGATAGACGGTTGGGCAGATGGAC
GA


invisible?    
Gene introns: 0  

>8039 101 280     10q23.33    chr10:94441602-94441702 BLAT!
TACCTAAAGCTCTACCTAAAGTTCCATGGTCAGTAAAATTCACCCACATGACAGTGGTAT
GTGAGGCACCTTGTAGTATGTAAAATGTGGAAAAAGGCCAG


invisible?    
Gene introns: 0  

>30323 167 280     Xq25    chrX:127985209-127985043 BLAT!
TTTGTATGAGTTCTAAGGGCCTGCAATTAATGATGCTTTCTTCCAGAGGGTTTTGTGTTT
GCTTCTTCTAGGTGCAAAGAGTTGTTACCAACTTGAGACATCTTTAATCTTACTTCTTGT
TTTGGAGTTTCCTGAGGATAGTATAAATGTAAACCCCAGACGTAACT


invisible?    
Gene introns: 0  

>13047 140 279     22q12.3    chr22:35140719-35140858 BLAT!
ATTTCCCAGGTCTGCGTTCCATTCATCCATCCGTCTAGGTCTGATATTCAGTAAGTAGAT
TATGGTTTGGGTTGTATTTTTTCTTTTAGAAGCCAGCATCCATTCTGACTGGGAGGTGCC
CATGTCCCATAGGGTTATTT


invisible?    
Gene introns: 0  

>25185 121 279     12q21.2    chr12:78017002-78017122 BLAT!
TATTAAAATTAGATAAGATCAAAAATAAAATAACAAAATTAGTTTAAAAATAAGAAAGGC
CTGTTTTTACCCAGTGTTTCTTAAGGCACCAGAGAGCCATGGGAGCATCTTGATTAGAGA
T


invisible?    
Gene introns: 0  

>26276 110 279     3p21.1    chr3:53931618-53931727 BLAT!
AGTCTTTTCAGATTGAGATGTTTCACAAGTATGGTGGAGACCATATGTGCAGAAAAGTGG
AGAAGCAAGTAGAAATGGATATACAGCCACCCTGGGTGCTGACCTGTTCC


invisible?    
Gene introns: 0  

>3378 145 278     4p16.1    chr4:11022035-11022179 BLAT!
GAGTGTGCTCGATATTAAGAGCACAGCAAAGAGAAAGGGACCTAGACTTAGACCTTGTCT
GAACCCATTAAAGTCTGGATGAGGAGACTTGATTCTGGGCAGGAATCATCTCTGGAGTTT
AAGGGGCAATAAAGCAAAACGCAGT


invisible?    
Gene introns: 0  

>12489 132 278     2p11.2    chr2:88508461-88508330 BLAT!
ATTATCTTAGTTCTACTTTTATAACATTCCCTGAGGGAGGTTGAAGAGTGTCTCCTTGAT
CTATATCTTACAGATGAGGAAATGGGTCCAGATCACACAACATTTTTCAGTGGGGAATTT
ATATTAGGTAAA


invisible?    
Gene introns: 0  

>19936 144 278     Xq22.1    chrX:100057042-100057185 BLAT!
CACTTGTTCCAAATGAGGAAGAAGCATTTGCATTGGAGCCTATTGATATAACTGTTAAAG
AAACAAAAGCCAAGAGGAAGAGGAAGCTAATTGTTGACAGTGTCAAAGAGTTGGATAGCA
AGACAATTAGAGCCCAACTTAGTG


invisible?    
Gene introns: 0  

>24500 131 278     4q32.1    chr4:161594334-161594456 BLAT!
AAAAAAAGTATTCAGGTTAATGTTCCTTACCTAAAATCAATTGCTTATGTATTTTTATCA
CATTTACAAAATATCTTCAGAGTAACTCATAGATTAGGGATTGACTGAATCACTGGGGAC
TGTAGGTTATT


invisible?    
Gene introns: 0  

>27386 135 278     5p15.2    chr5:13534747-13534613 BLAT!
CAACTTCCCCTTCTGCCACATTTCTTGGATGGACTAGTCTACCTTCCTCTTCTGCTATGT
GATTACATTGAGCAAGCCTGATTCAGAAACTTAATTATAGAAGAAGGCTTGTGAATGGCA
TTCAAGATGGGGCTA


invisible?    
Gene introns: 0  

>32901 111 278     2p16.3    chr2:52547086-52546975 BLAT!
AAATTTGGAAATGTTTCCTTTTAAGTAAGGAATTAGCAATAAGCCTAGTATATCATTGCT
AATGTAGGGTATGGGACAAAAGTAGCATCATGCAGTATAACCATAAAGTAG


invisible?    
Gene introns: 0  

>10513 139 277     10p11.22    chr10:34228691-34228553 BLAT!
AAAGAAAAAAACAATGAAAGAAACATCTTTTTACTAAGGTTTACTTGGTCAGTGAAAGCA
TTGTGGGAAGTCGGCATGACTATTTAACTATATTCCTTCTCTACTTTACATTACATGTTT
GGAGCCTTAAAATATACAT


invisible?    
Gene introns: 0  

>12670 118 277     3p21.32    chr3:44194489-44194372 BLAT!
ACTGCACAGGGGTCAGTGCACCTAATCCCCACCAACCTCCCCGCCATTGGTCAACGGTCA
GTCATACATACCAACATTGTTCATGAGTATAGATGAAAAAATACCCAATAAAATATTA


invisible?    
Gene introns: 0  

>19999 129 277     5p13.1    chr5:42108935-42108807 BLAT!
TAATTAGCACATTTATTTCTAAATTATAAATAAAGCTATTCCTAAGAATTTGGCTTTAAT
CCTAACCCTTGCTTTAACCCTAATGTTTGTCAAACAGATAAGGATCTGTTTATTTAAGAG
ATATCAAAT


invisible?    
Gene introns: 0  

>28699 144 277     10q21.1    chr10:54790783-54790926 BLAT!
CTGGTTAGGCACGGTGGCTCACGTCTATAACCCCAGCACTTTCGGACACCAAGGTGGATG
GATCACCTGAGGTCAGGAGTTCAAGGCCAGCCTGAGCAATCTGGTGAAATCCTGTCTCTA
ATAAAAATACAAAAATTAGCCTGG


invisible?    
Gene introns: 0  

>920 102 276     7q35    chr7:145104012-145104113 BLAT!
TCCACACTGAAGATGCTATTCACCCATTGGGCATCAACATTGTCTGTTCCTGACATCCAC
CCACCAACATCTTCATGGTTGGATAATTCAGGATCACCTAAA


invisible?    
Gene introns: 0  

>12552 164 276     7q31.33    chr7:124985313-124985187 BLAT!
AGAATGGTGTATAGATGGCCAAATACCAGTGCGTCAAGTTCAGTAGGCTGCTTATTGAAG
AAATACGGTTGTGTTCCCAGTCTTTGAGAGAGAGCTTGACAGCACTGGTCTACATCCTCT
AAGACCTCCCCTACTGTAGCTTCATCACACCACTGAAGATACAG


invisible?    
Gene introns: 0  

>15088 101 276     9p13.2    chr9:36747791-36747891 BLAT!
AGGTCAGGAGTTCAAGACCAGCCTGGCCAACACGGTGAAACACTGTCTCTTCCAAAAATA
CAAAAATCAGCCAGGCGTGGTGGTGCACACCTGTAATCCCA


invisible?    
Gene introns: 0  

>15777 107 276     18q12.3    chr18:39382799-39382693 BLAT!
ACACACACACACACACACACACACACACACACACACAGAGTCTTAGGCCGGGAAGTCCAA
GATCAAGATGCTAGCAGATTTTGTGTCTGGGGAGGGTTTGCTTTTTT


invisible?    
Gene introns: 0  

>17597 130 276     5q21.1    chr5:101452891-101452762 BLAT!
TGGGAAAACTGTTTTTGGCCTTGTGATCATCAACCTTTGACTTCTTTTTGTGGTGCAAAT
AGATTTATACCCTTGTTGTCTCCCAATTTTGGAGGGACAATTGATTACATTAATTATCTT
CAGGTTAGTT


invisible?    
Gene introns: 0  

>26709 104 276     20q11.23    chr20:36817291-36817394 BLAT!
ACACACACATCAATGCAATGTCTCTAATATAAAGGAGACATAAAATGGAAGTGACTTATG
ATAAAATAATGTGTATTTCAATATATTCTTGGGCACAACGACCC


invisible?    
Gene introns: 0  

Shown 2341-2370 from 3142 sequences on 79 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs