Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2401-2430 from 3142 sequences on 81 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>16286 148 269     4p15.31    chr4:18517750-18517603 BLAT!
ACAGGGTTTCACCATGTTGGCCAGGCTGGTCTTAAACTCCTGACCTCAAGTGATCCACCT
GTCTTAGCCTCCCAAAGTGCTGATATTACACGTGTGAGCCACCACTTCCAGGGTCTACCT
TACATTATATGTAGTATGAATGGAAACA


invisible?    
Gene introns: 0  

>22484 164 269     15q25.3    chr15:86387548-86387385 BLAT!
CCCAGTCAGCCCCCTCACATACTTTAGTTACTTTTCCACAATTGCCTGCCTTTGTTCAAC
TTAATATAAGAGCATTTAGGTTTTGTCACTTATTTGGGTATTCATTTTCTCATGAGAGCT
CCCATGTCACATGAAATTTATATTAAGTAAATTTGTTTGCTTTT


invisible?    
Gene introns: 0  

>26857 154 269     6q27    chr6:166507845-166507998 BLAT!
TCGAGGAACTGCCACACTATTGTGTCTTTCACAATGGTTGAACGAATTTACACTGCCACC
AACAGTGTATAAGCATTCCTTTTTCTCTGTAACCTCGCCAACATCTGTTATTTTTTGACT
TTTCAATAGCCATTCTGACTAGTGTGAGATAGTA


invisible?    
Gene introns: 0  

>13892 115 268     4q32.2    chr4:163407535-163407421 BLAT!
ACAAAATTTTAGTCAATAAGGTGAAACAAAGCAACCTTAAATAATCAGTCTGCCAACAAG
TATTAAGTAGATGCTGTTTCTGTAATTGTAAGTAGATTCCCCCAAAGAATGAGCC


invisible?    
Gene introns: 0  

>14304 129 268     9p21.3    chr9:25527673-25527801 BLAT!
CCTTCATCCTCAAGCTACTCAAATATAACTATACATATACCCATTAAGTTGAATATGACT
ATGAATATACATTTTTCTAAGTTTCATAAAAAGATCAATTGCTCTTGGAATCTTTACATC
TTTACACAT


invisible?    
Gene introns: 0  

>25278 136 268     4q32.3    chr4:168190369-168190504 BLAT!
CAAGCTAATTTTTCTAATAAAATGTCATAGAAAATTAATTTATTCTTAACCTCTATAAAG
GTTAATGAGTAAAGGATAAATAAAATGCACTTAAATCAATACTTTGATGGAGTGTCAAAA
AACCTGATAATTCAAT


invisible?    
Gene introns: 0  

>33297 144 268     7p14.1    chr7:40926945-40926802 BLAT!
CTGGTTTCCAGCTTCCAGACCTTTTCCTACCCAACACAGTCTCCAAATATGTATGGTCTT
TCTGACTCATAAGTATGTCATATCACTCAGCTGCTTAAATTCCCCTTGGTAACTTCCCAT
TTTATTTAGAAATATTAATAAATT


invisible?    
Gene introns: 0  

>3329 136 267     11p12    chr11:37838254-37838119 BLAT!
TTGGAATTAACTTTTTTGTATTTTGAAGATGCGTTCACAGTTTCAATTTAGTATTGGGTT
ACCCACTTACCTTGTTTCTCAGGTGTGAATCATTCAAACCATGTTAATTAGAGCTTTCAG
AGAGCTATACCTGTAG


invisible?    
Gene introns: 0  

>8237 137 267     17p12    chr17:14815302-14815166 BLAT!
AAGCAGACAAAACTATTCTACGGTGCAAGACATCAGGTGGTGGTTACTATTGTGAAGGTC
AATGGTCAGAAGATGCTCCTGGGGTGGCGTCTATAGTGCTGGTAATGGGACGGAGAGCTG
GCACCGCATGTTCAGTG


invisible?    
Gene introns: 0  

>13935 136 267     5q35.1    chr5:171897223-171897328 BLAT!
GGTCCTAACATTCCAGCTGGTCTGCCTTCTTCTCTCCACCTTCCAGAGTCTTCTTACATT
TGTTTTATATCAAATATCTAGGATTTTTTTGTATTTAGTGGGAACCCCGCGTACGCGGGG
CTCACAACAAAACTAA


invisible?    
Gene introns: 0  

>23282 111 267     5q21.3    chr5:108765820-108765930 BLAT!
TTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATTGCACCATTGCACTGCAGCCTGG
GCTGCAAGAGCGAAACTCCATCTCAAAAAACACAAAACAAAACAAAAATTA


invisible?    
Gene introns: 0  

>29488 125 267     3q13.11    chr3:105664674-105664798 BLAT!
TTTAAATACTCTTGTTCTCATGTATGTTCTATCATCTCCACTCTGAAAAATGATTTCTTT
TGATGGAACAGATAGTAAAATACTGTATAGTGATTAAAAATATGGGTTCTATAGTTAGGC
TACTT


invisible?    
Gene introns: 0  

>32145 139 267     4q22.1    chr4:91967973-91968111 BLAT!
ATTCCCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGATGTAAACAAACATGCCCAGC
TAATTTTTTGTATTTTAGTAGAGACAGGCTTTCAGCATGTTGGCCAAGATGGTCTCGATC
TCCTGATCATGTGATCTAC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>9451 147 266     7q11.1    chr7:61286150-61286015 BLAT!
CACAGTCGAACTTTCTTTTGATTGAGCAGTTTGGATACAGTCATTTGTATTATCTGTAAA
TGGATATTTGGAGTGTATTGAGGCCTATGGTGAAAAAGGAAATATCCTCACATAAAATTC
AGATGGAAGCATTCTTAGAAACTCCTT


invisible?    
Gene introns: 0  

>19330 171 266     9p24.1    chr9:5215164-5214994 BLAT!
AGTTATTTGTAGATTCTGGATATTAGTCCTTTGTCAGATGGATAGATTGCAAAAGTTTTC
TACCATTCTGTAGGTTGCCTGTTCACTCTGATGATAGTTTATTTTGCTGTGCAGAAGCTC
TTTAGTTTAATGAGATCCCATTTGTCAATTTTGGCTTTTGTTGCCATTGCT


invisible?    
Gene introns: 0  

>21203 127 266     9q33.2    chr9:123040304-123040178 BLAT!
ACATTGGCCTCCCTCTTCACCTGGGAACTCCTACTCATCTTCTAATACCTGTTTAATAGA
CACCTTCTCCAGGAAGCCTTCTTTGGGGGACCCTCTTGCTGCTTCCACAGCCAGCTGGGT
TTACCTT


invisible?    
Gene introns: 0  

>25804 114 266     8p23.1    chr8:8804191-8804304 BLAT!
ACTTTGGGAGGCCAAGGCAGGTGGATCACTTGAGGTCAGAAGTTCAAGATTAGCCCGGCC
AACATGGTGAAACCCCTTCTCCACCAAAAATACAAAAATTAGCCAGGCGTGGTA


invisible?    
Gene introns: 0  

>7581 147 265     5p15.33    chr5:2788385-2788270 BLAT!
AGAAGATAGCTCCAGTTTTCTTCAGAGAAGAATATATGCTGAATAATGCTGTTGGTTCTT
GCCAGAAACCTTATGTTGCACTTATTCATGGAATTACAATGGGTGGGGGAGTTGGTCTCT
CAGTCCATGGGCAATTTCGAGTGGCTA


invisible?    
Gene introns: 0  

>10572 120 265     3p13    chr3:70175432-70175544 BLAT!
AGCCTGAAGTGGGACATGGGGAGTGAACTCGATCTTGCTCTTTTGCAAATTCAACGACTA
AAGTATGACCTAAAAGTTTCAGTTGATGGAGTCTTGTCAATGCCTTTATAGCTGCTTTTT


invisible?    
Gene introns: 0  

>26228 113 265     4p13    chr4:41925689-41925577 BLAT!
TCTGCAGCTCAATTTTACAGGCAGTTTTGTGTTAGAAACACATGTTGTAAAGGGAGGGGA
TGTTCATGGAAACTCAGAAAAAGGAAGTCATGTAGAGAGTGCTGCAGTGGCAG


invisible?    
Gene introns: 0  

>27633 130 265     6p22.3    chr6:18671859-18671988 BLAT!
CCTTAGCTCAGATGCTAGCTTTCTAGAGAGAACTTCCATCACCTGGCTCCAGTCTTCATC
ACTCTCTATCACGTTGCCTTACTTTATTATTCTCATGACACTACTGCTAACCAAAATTAC
TTTATTAATT


invisible?    
Gene introns: 0  

>31339 136 265     11p14.1    chr11:30760567-30760702 BLAT!
CAGCCAGCCTGTTTTCTCTCTTGGATTGGTTTGGGGATTAGAGTCAGTGTGAAGAGGGGT
TAGCTGGTGTTTCTAGGGAAAGGAAGGTTTCTTTCTCTACTATTGTAATTGGCAGAGTAT
GAGTGTGAAGCCTGCA


invisible?    
Gene introns: 0  

>103 100 264     8q23.3    chr8:116208871-116208784 BLAT!
CAGTCACTACGCTCATCTTCAAGGCTCTTGTCTCCTTTGCAAAACTTCCTGAAACACCAC
TGCACTGTAAGTTCGTTAGCAGCTTCTGGGCAGAATGCAT


invisible?    
Gene introns: 0  

>947 101 264     10q23.1    chr10:85021272-85021371 BLAT!
CGGCCGAGGTGGGTGGATCACCTGAGGTCAGGAGTTCGAAACCAACCTTACCAATATGGT
GAAACCCTGTCTCTATTAAAAATGCAAACATTAACCGGGAG


invisible?    
Gene introns: 0  

>5342 131 264     18q21.32    chr18:57600802-57600672 BLAT!
GGAGGCTGAGGCAGGCAGATCACTTGAGGTCAGGAGTTCGAGACCGGCCTGACCAACATG
GAGAAATTCTGTCCCTACTGAAAATACAAAATTAGCCGGGTGTGGTGGTGCATGCCTGTA
ATCCCAGCTAC


invisible?    
Gene introns: 0  

>8698 122 264     18q21.33    chr18:60361483-60361362 BLAT!
GCTCACATCTGTAATCCCAGCTACTTGGGAGGCTGAGGCACAAGAATTGCTTGAACCTGG
GAGGTAGAGGTTGTAGTGAGCTGAGATCACACCATTGCACTCCAGCCTGGGTGACAGAGT
GA


invisible?    
Gene introns: 0  

>11966 111 264     1p21.1    chr1:103628806-103628916 BLAT!
CTCCCGAGTAGCTGGGATTACAGGCATGCACCACCACACACGGGTAATTTTGTATTTTTA
GTAGAGACACAATTTCTCCATGTTGGTCTGACTGGTCTCAAACTCCCGACC


invisible?    
Gene introns: 0  

>16636 126 264     2q32.2    chr2:190412415-190412290 BLAT!
AACCAAAGATGTCCTTTTGAAGAAAGTAGTCTCCCATCCCTCTGTAGGTGAGTTCAGACT
CCAAGATAAATTAGAAATATAGACCAGGATGATTCATTGTCAGCTTGTGGGGAAGCCCAA
GAAGAC


invisible?    
Gene introns: 0  

>22114 165 264     7p22.2    chr7:4072277-4072113 BLAT!
TGCTGATTTTATAGCTTGCTAGTTTGCTAAATTCTTTATTGCTCATAGTAGTTTCCAGAT
ATCATATATTATTATCTGCAAATAAAGATAGTTTAATCACTTCCTTTTGGGGATTTATAC
CTCGCCTTGCTTTCTCTTGTCTACAGCTGTGGCAAATGTGTCGAT


invisible?    
Gene introns: SDK1 (3341079 - 4308631)  

>29976 103 264     22q12.1    chr22:28638180-28638235 BLAT!
GTCTACTCTCCAGCATTCCCCGGCCCTTTACTCCTTCTAATGGAGTGGGTGGTACAGATG
ACGGCTTTGTATATAATTTGGATGCACGTTCAGATAAGCCAAT


invisible?    
Gene introns: TTC28 (28374001 - 29075853)  

Shown 2401-2430 from 3142 sequences on 81 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs