Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2431-2460 from 3142 sequences on 82 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4324 146 263     7q21.11    chr7:84527780-84527925 BLAT!
TGGACAATAAGCATTTTGGTAACTATTCCTCAAAATGTTCCCTTTTGGATCATGCCTCCT
GGTATTCACACCCCTCCTCCAATATGAAATCTTCTCTGGCCCCATGTAACTAAAAAATTG
TGGCATAAATAATGCTGCATGAGTTT


invisible?    
Gene introns: 0  

>10825 122 263     16p12.1    chr16:24431345-24431466 BLAT!
TTGAAGGCCCAAATAGAAAAAAAAGGCAGAAGAAGGGTGAATTTTCTCTCACTCTGCTCA
GGCTGACATGTCCATGGCTTTTAAATTTCAAGTGAAAACAAAAGTAAGTAGCTGAAAACA
TT


invisible?    
Gene introns: 0  

>20951 114 263     4q22.1    chr4:90072635-90072748 BLAT!
ACAATGGTGCCCGAAACCTCATTAGCAATTTTAATTTCTCCCCGGTCCTGTGGTCCTGTG
ATCTCGCCCTGCCTCCACTTGCCTTGTGATATTCTATTACCTTGTAAAGTACCT


invisible?    
Gene introns: 0  

>20983 134 263     9p22.3    chr9:16198023-16198156 BLAT!
AAATATACAAAGTCCTAATGGCTAATCTATTCTTCTAAGTATGTGGAAGGCTACTACACC
GAAGAGACTTGATCTAATTGTATAATAAAACTCAAATCATTTCCAGCCAGATCGGACATG
CCAGGGCTGCTGCT


invisible?    
Gene introns: 0  

>21857 134 263     10p14    chr10:8117556-8117689 BLAT!
TGTTTTGCTTTTCTACTGTTGAATGAATACCACCACAGTGAAGGGATTATTGGAATGTTT
TCGAAACACAAAATAACCATTTTGTAACTTCTGCTGTATAGTTTTCTTTTCCTGTGGATG
GAGTGTGTAACTAC


invisible?    
Gene introns: 0  

>22865 112 263     2p24.2    chr2:17514388-17514499 BLAT!
TTGGGGAAGAGGCTGGATGTCAGTATTTTTTAAGTGCCCTTAGGAGATTCTAATGGGTTG
CCAGGGTTGAGAACAACTAGCCTCTTGCCAAATGAGGCACAGGAAGAATCAA


invisible?    
Gene introns: 0  

>4805 124 262     2q22.1    chr2:142149754-142149631 BLAT!
AATGAAATAAGTAATATAGACTATTTAAACACATTGAACAAAGAGGGCTGTCATTAGTAA
CCCATGCTCCTGAGTTTCCTTGCTTCATCAGCTTAACCAGTCAATCCAGAGGTCATAATT
TTTA


invisible?    
Gene introns: LRP1B (140988995 - 142889270)  

>19874 116 262     Xp11.21    chrX:57247422-57247537 BLAT!
GGCCAGTATATTTTTAAATTAATACCAGGCAACCTACTCTGCTTTACCTAATTTTTCAGG
AACCACCCAGTCCTCCCAGGTGTCTGTTGTAGGAATTAATGGACAAGTCTCCAAAC


invisible?    
Gene introns: 0  

>5285 116 261     5q32    chr5:146906737-146906622 BLAT!
GGGACCAGGGCTCTGGCTTTAAGACAGAAGAAGATCCTGGTTTTAAAGTCCTTGTCAAAG
GAAACAGAAAGCAGTAGGCACCTTGACCTGTGTAGGCTCGGGGAGCACTTGGTTTT


invisible?    
Gene introns: 0  

>5912 103 261     10p13    chr10:16167681-16167579 BLAT!
GGTATATGGGCCAGTTGGTGTTTGGTTGATCAAAGCTGGAGTTGACTGGCCTTGGCTCTA
AGATGCAGACTGAGCTCAAGTTTTCTCTTCTTCTCTCACCCTC


invisible?    
Gene introns: 0  

>9997 115 261     2q31.3    chr2:181725791-181725905 BLAT!
CATCCCCTACAGAAACTACAGAAATGGATCTGCTCGTGACTCGGCCTTTAAAATAAATTA
CTATATTGTTTTTAAACGTCTCCCTCCTGTCAGCTATTAACGTATGTTATGACCT


invisible?    
Gene introns: 0  

>23179 131 261     3q25.31    chr3:155706043-155705921 BLAT!
AAAAAAAAGACTGCAACTTGCTCCCAGGGACTGGAGAAAATTTAAAAAAAGGAAGGTTGG
AATCCATCAGTGTTCTATTTAGTCATCTTCTCCTTCATCCTCCTCTCCTTCCTCCCCTTC
ATCATCATCTT


invisible?    
Gene introns: 0  

>23609 130 261     12q14.1    chr12:60917650-60917521 BLAT!
AAACAACCAACCTGATTCAAAAATGGGCAAAGGCTAGACATGATGACTCACTTTTGTAAT
TCCAACACTTCAGGAGGCTGACATGGGAGAATCACTTGAGGCCAAGAGTTTGAGACCAGC
CTGGAAAGAT


invisible?    
Gene introns: 0  

>2598 140 260     7p21.3    chr7:11914139-11914000 BLAT!
TGTAATTTTGGCCCAGGGACACTCTGTTAAGGCTGTAAGCAATGAGATAATCATGGGAGC
AGTGAAGCTTTTATGTCACTTATTTCATGTGCCAGCGTGTGGTGTAGTAAACCCATGGGA
TCACTGGTGTTGCCTACAAA


invisible?    
Gene introns: 0  

>6125 116 260     9q21.31    chr9:82418198-82418083 BLAT!
TTTTGAAGGAGCCCTTATCTTTTAGGCAAGTATGTTGAAATATTTACAGAAGAGATGACA
TGATATCTGGGATTTGCTTTAAAATAATGTTGGAGGGTAGAGATGAATGGAGGCAT


invisible?    
Gene introns: 0  

>18759 118 260     18q11.2    chr18:20160661-20160778 BLAT!
GTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGTGTGAACCCGGGAGGCGGAGC
TTACAGTGAGCCGAGATCGCTCCACTGTAGTCCAGCCTGGGCAACAGAGAGACTGTCC


invisible?    
Gene introns: 0  

>27136 119 260     6p21.1    chr6:42579417-42579535 BLAT!
GTGGATCACTTGAGGTCAGGAGTTCAAGACCAGCCTGGCTAACATAGTGAAACCCTGTCT
CTACTAAAAATACAACAGTTAGCCAGGCGTCGTGGCGCATGTCTGTAGTCCCAGCTCCT


invisible?    
Gene introns: UBR2 (42531759 - 42661243)  

>6163 123 259     1p32.1    chr1:59716850-59716728 BLAT!
AGGACCCTCCAAGCCAGGCGCGGGATATAATCTCCTGGTTTGCCGTTTGCTAAGACTGTC
GGAAAGTGCAGTATTAGGGTGGGAGTGACCCGATTTCCCAGGTGCTGTCTGTCACCCCTT
TCC


invisible?    
Gene introns: 0  

>7412 142 259     4q13.1    chr4:65329561-65329420 BLAT!
AGAGACAATGATTTCAGAATTGTATTTTGTATCATTGTATGAGGAAATAAATCTGCAAGC
TTTCATTCATTCACTTCTGCAAGCTTTTGAAATGCATTTGTATAAGGCCTATTATTTGGT
AATATGGATCAGAAGTGAAGTA


invisible?    
Gene introns: 0  

>13971 127 259     1q42.2    chr1:232236768-232236642 BLAT!
ATCCACCAAGCAGCTTCCTTAAGTGGAGGTAGAAGGAGGCATACCACCTGCTCCCATATG
GGACATTCCGATTTCATCTTCATCTACATAACAACGTTTTTCCAACTCTGCAGTGCAAAA
TGTATTT


invisible?    
Gene introns: 0  

>15485 119 259     5q33.1    chr5:152653952-152653834 BLAT!
TTCTATCTGTTATTACATTTGCACAGCACATTTCCATTTACAAAGTGCTTTCACATTGCA
ATCTATAATTTGATTCTAACAAGATCAAATTACTAAGACAGAAATAATTATCTTTTTTT


invisible?    
Gene introns: 0  

>16912 129 259     17q22    chr17:53696097-53695969 BLAT!
ATGGCACTGAGATTGTTTTTTTCCAGATTTTTCCTATTTATGAGCATTTTAAGGAAGGGG
ATTATGTCAAACATCTTTTTACATTTCGAGACCTTGCCTAGTCCTGGCACAGTATAAGTC
CAATGTATG


invisible?    
Gene introns: 0  

>21897 129 259     19p13.11    chr19:18347435-18347563 BLAT!
ACAGCATGATTACTTTGTCCTGTCTCTGCCTGGTATGATCTGTCTCCACCATCAGCCTGT
GGGCACCTCCTTGTGCATGGCTGTGTGCCCACTGTGTGCCAAGTGCAGGGCCTGGCACAC
AGTGGGGGC


invisible?    
Gene introns: PDE4C (18318770 - 18359010)  

>22107 140 259     2p24.3    chr2:12983598-12983459 BLAT!
TTTTTTTAGCACTGAATAATACTCCATTGTCTGGATATATCACAATTTATTTATCCATTC
ACCTTTTTAGCACTGAATAATATTCCACTGTCTAGATACATCACAATTTATCCATTCACC
TACTGAAGGGCATCTTAGTT


invisible?    
Gene introns: 0  

>2471 130 258     13q21.2    chr13:62205660-62205531 BLAT!
AACTAGGAATATGCATTGGCCTAGATACCCTTTAAATAGCCAGTAAAAGAAAGGTTTGGG
TTGCAGTATCAAGGGTCAAAGATTAAAATAAATCTCCAAAATCTCCTCTCACTACTATAA
CAAAGGCAAA


invisible?    
Gene introns: 0  

>5298 140 258     10p15.3    chr10:2281122-2281261 BLAT!
ACAAATATGCCTCATAGATGCCAGCTGGTGAGGTTAAATCAGAGTCTCTGCCTTCTAGAA
ACTTGTAATTAGTCAGAAGATATGAGGCACATTCATAGATGGCCACTGTTTAGGCACACT
CTGGATCATGTATGCCCAAT


invisible?    
Gene introns: 0  

>13397 110 258     6q27    chr6:167479856-167479747 BLAT!
GGAAACACTTACTTACATTTACCAGTTTATTATAAAGGATATTACAAAAGACACAGATAA
AGAGATGTATAGGTTGAGGTATGAGGAATGGGCTCAGAGCTTGCATGTCC


invisible?    
Gene introns: 0  

>18629 119 258     9q33.1    chr9:120792089-120792207 BLAT!
TAAGGTTTATCTGGGTCCTCTTGGCCAAGAAAGGGTCCACTCAGTTTGGAGATTTAACTG
TGAATAAGGTAGAAGATATACCTATTTTCTGGGAGGATGTAGACTGGTGAGGAGAAAAT


invisible?    
Gene introns: 0  

>19411 128 258     18q11.2    chr18:20197935-20197808 BLAT!
TCCCTTTGTGAGTAACCCGACCTTTCTCTCTGGCTTCACTTAACATTTTTTCCTTCATTT
CAACTTTGGTGAATCTGACAATTATGTGTCTTGGAGTTGCTCTTCTCAAGGAGTATCTCT
GTGGCGTT


invisible?    
Gene introns: 0  

>2868 139 257     18q21.2    chr18:51567574-51567712 BLAT!
TCCACTTTGCTTTGACTTGTTGTGCTGATATTTTCCATTTCTAAATCTCTAAGTTCTTTT
AGCTAACATCTAAAAGTTCCACTCTTAAAATTACTTTCAGTCATTTTTTCCTTCCCAAGC
AGGTTCTTGGGAGCCCCTT


invisible?    
Gene introns: 0  

Shown 2431-2460 from 3142 sequences on 82 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs