Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2461-2490 from 3142 sequences on 83 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4228 136 257     1q24.2    chr1:169751772-169751637 BLAT!
TATGAAGCTGGCTCAGTGACTGATGAAAGACCTTCCAATTCTTTATTTTTCCTGTGTCAA
TGAAAAAAGCCAAACTCTATACAATATTTAAAGAAGTTTACTGTGAGCCAAATATGAGTG
ACCAAGGTCTGCAACA


invisible?    
Gene introns: 0  

>5823 130 257     10p11.21    chr10:37767005-37766876 BLAT!
AAGTTAAAAAAAGAAGTCTTTATGTTTTACAACTCCTTTCTTTGCTAGGTTAAAAGGACA
GAAAATTCCAAGCATCTGTGTAGAGTTAATATACCAGGTGGCTCTTTTCCAGCACAGAGG
TGTGTGAAAA


invisible?    
Gene introns: 0  

>13357 122 257     4q28.3    chr4:135789261-135789140 BLAT!
ATTATAGGTTAATACCTATAATTTAAAATTGATAACTACTTCTAATATTTATTACACTAG
TTAACAAGTCAATACTTGTATTAATAAAAACAATTTTACTTTAAATATTTGAATTAGCAA
AT


invisible?    
Gene introns: 0  

>16736 126 257     20q13.2    chr20:51542369-51542244 BLAT!
AAGTTAATGACTTTGGAGGGGTGTGAAGAAATAAACATGGTTCCCTGAAGGCGTGGACAG
GTGCACAGGGCTGGAGCCCAGGATTTTGTGGAAATTAGTATGAGGTGGGGCCTAGGAAGG
AGCAGA


invisible?    
Gene introns: 0  

>19799 109 257     3p12.2    chr3:81350292-81350184 BLAT!
AATGAGGGTTTTGCTTGAAAACCCATGAGAAATATTACAGTAGTGATTCAAAAATGCCAT
AAGGGTTCCTTTACAGAATAGAGCCAAGAGTCACCTGGAGTCCCCTGAA


invisible?    
Gene introns: 0  

>32102 122 257     9q31.1    chr9:104326794-104326915 BLAT!
AATGTTGTGGAGGAAACCACTAGCCCCATGGGAAGTTGGATTTAGAGGAAGTTCCTCTAG
TTGAGATGAGCAGGGAGCCCCTGATCCCAACCGGCTTGAGGTCCTGGCAACACAAGTTGA
GC


invisible?    
Gene introns: 0  

>13615 100 256     14q22.1    chr14:53478647-53478711 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGGTTTCCGGTTGGCTCCGGTTGCAGAGTTGAG
TGTCCTGAGAGGTCAGATTGCTGTCAGACATGGCCCATGA


invisible?    
Gene introns: 0  

>15424 106 256     6q24.1    chr6:141619642-141619747 BLAT!
TTTTCATTACATCTATAGCTCTCTGATGATATATTAAAATATTTGTATAACTATTTTCAG
CTTTATCTAGTTTCCTGTGGGGGTATTGTTTGGCTAAACCTATTAT


invisible?    
Gene introns: 0  

>19536 108 256     5q21.3    chr5:108765295-108765188 BLAT!
TGAAACTGTTTGTATTATTATGCTGCTCAAGATTCAAATTCTAGGGAGAGAGAGAATCGG
ACTGGCTTATCTTGTGTAATGGATCCACTTTTATATACCAGGCAGGGG


invisible?    
Gene introns: 0  

>25132 134 256     1q24.2    chr1:168126715-168126813 BLAT!
GTCATCTGCAAAAAGGGATAATTTGACCTGCTAGTTTCCAATTTGGATACCCTATATTTC
TTTTTATTGCCTAATTGCTTTGGCCAGGACTTCAAGTACGGCCAGGGCTATTGGTTGAAT
GAGCAGGCTGATGG


invisible?    
Gene introns: 0  

>33279 107 256     13q12.3    chr13:30744714-30744608 BLAT!
TCTTCATTAAATGTTTGGTAGAATTCATCAGTGAAGCCATCTGGTCATGGGCTTTTATTT
CGTGGGACATTTTTTGATGACTAATTCAACATCTTTCTTGTTATAGG


invisible?    
Gene introns: 0  

>5722 141 255     21q22.3    chr21:47044388-47044528 BLAT!
AACTGGCTGGGCCCTTTTTGCCCTTGCATCATCCACCACATGAGGACGCAGCCACAGGGC
ACCGTCTTGGAAGCAGAGACAGTCCTCACCAGACACCAAACTTGCCGGCACCTTGATCTT
GGACTTCCTGCCTCCAAACTG


invisible?    
Gene introns: 0  

>9215 156 255     1p31.3    chr1:62853997-62854152 BLAT!
ATCCTATTTTCCACCAAAAGCAGCCAGGGCTTTTTGGAGAAATAGCTGATTCCAAATCTG
GGACAGAAAATTGCAAGATGACCCTGGATTGCTTTGTCATATTAGAAAGCAAGAAAACTA
TCAAAGACCAGTAGGTTTGTTTCAGGAAGACTCAGC


invisible?    
Gene introns: 0  

>7441 119 254     1q24.1    chr1:166671376-166671494 BLAT!
TTCTAAGCTTTTGTAATTTTAGAAAAGCTGGCATTAGATGACCAACAAATAAAAAATATA
TTTACCTTTAAGAAAAGAAAAATAGAGCAATTTGAGCTATGTGAGCTATGCAAAATTTA


invisible?    
Gene introns: 0  

>9145 141 254     4q22.1    chr4:91946985-91947125 BLAT!
GTGTATGTGTGTGTTTGGTTTTGATTTTGTCTGCTTGTTTATTTTTAATTCACAAGCTTT
CATTTTCCTGGGAACACAGCCTAAACTCACTGAGGATTGGGCTAGATGAAGAGGGATGAA
CAATCTGAATAACAAACACAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>10240 154 254     3p22.1    chr3:41139361-41139208 BLAT!
AAGCAGATTTGGAGAGAGTAGGATGCAGGAAAAAATGGGTAAGAGGTGAGCTGGGAGGCA
AGGAGGGAGGGGACTGGTAGGTGATATGATCAGATTAGGCCTTGTAGGTCATTGTTAAGT
ATTCTGGCTTTTCCTCCTGATTTGAGATGTAAGC


invisible?    
Gene introns: 0  

>11342 102 254     4q12    chr4:58352145-58352044 BLAT!
GAAAATGCAAAACAATGGCTGAGCCTGACATTCCAGCTATGAAACTCACCTATGCTATAA
GCCCACTCCAGCCCAAGGGAAAATTGGGAGAAAGGGAGGAGG


invisible?    
Gene introns: 0  

>15554 144 254     4q28.3    chr4:132583467-132583610 BLAT!
TGCTATTTTGTTATATATTTTAAGATAATTTCTATTTGATGTTGAAACATTTTTGCTAGA
TATCTTAAAATCATATTCAGATGATTCCAACATCTGATGCGTTTTGGTGTCGGTGTCAGT
TAACTGTCTTTTTTCACTCAAATT


invisible?    
Gene introns: 0  

>21467 108 254     20q13.31    chr20:56065615-56065722 BLAT!
ATGAAAAGACAAGACACAGACTGGAAGAAAATATTTACAAAACATATGTCTGATAAAGAA
CTTGTGTCCAGAATACATAAATAACTCTCAAACAACCCAGAGTACAAA


invisible?    
Gene introns: 0  

>21948 142 254     4q32.2    chr4:164009922-164009781 BLAT!
ATAGAAGTTATGTGTCATTTAACAATGGGGATACATTCTGAGAAATGCATCTTTAGGCAA
TTTTGTTGTTGTGCAAACATCAAGAATGTAGAGACACAAATCTAGTTGTTATAGCCTGTT
ACACCCTTAAGCTATGTGGCAT


invisible?    
Gene introns: 0  

>8421 103 253     9p24.2    chr9:4365368-4365266 BLAT!
GGCCAGGCTAGTCTCAAACTCCTGACCTCATGATCCACCTGACTCAGCCTCCCAAAGTGA
TTACAGGCATGAGCCACCGCACCCAGCCTGATTTGATCTTTCT


invisible?    
Gene introns: 0  

>12847 138 253     12q23.2    chr12:103401800-103401663 BLAT!
GAGACTTGGACATATCTGCCTTGGTGTTTTCCAGATACTTTAAATTCATTCCGTCAGTGT
CTTCCCCATGCTTGCTGCCTACATTATGTTAACAGCATCCCCACCTACCTGGAAGATGTT
CATTTAGGAGACTTAAAG


invisible?    
Gene introns: 0  

>14750 141 253     8p21.3    chr8:20923858-20923718 BLAT!
ACTGGCGAAGACACTATCACTTCCAATGAGGCCATATAGAGCCTTACTTCAGGCCACTTA
TACTTCCACTCAACGTGGACAACCAGATGTCTCACCTGCTTGTAGTGCTTCTCTTCATTG
CTCTTAGAGGATCACCCCCAA


invisible?    
Gene introns: 0  

>14794 116 253     2p24.3    chr2:13837215-13837100 BLAT!
CAAATTTATTTGATCTAGGTTTCAATTCTTACGGTCCAATAAGTGATTCCAATATCCTGA
TATAGTCCCCTTTAGATTAAATTGTTCATCCATAAAATAATATATTTGGAACTAAC


invisible?    
Gene introns: 0  

>4514 115 252     15q21.2    chr15:51253767-51253653 BLAT!
TTTATCATGATGGGATGTTGGATTCTACCAAATGAATTCTCTGCATCTATTGAGATGATC
ATATGGTTTTTGTCCTTTATTCCGTTAATGTGAAGTATCACATTTATTGATTTTT


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>4691 120 252     Xp22.32    chrX:4837066-4837185 BLAT!
CTAGAATTTTTCTCTTTCTTCCATCAGTTCTGATTTGGCAATTATGCTTAAAATATTCTT
GTAACGTCAGAGACTAACCTTCCGATAACCTTACAAATGTGTATCCTGCCATTAATAGTC


invisible?    
Gene introns: 0  

>14454 123 252     13q13.1    chr13:32697310-32697188 BLAT!
TGTGAAGAATGACGGTGGTATTTTGATGGGGATTGCATTGAATTAGTAGATTGCTTTTGG
CAGTGTGGTCATTTTCACAATATTGATTCTACCTATCCTTGAGCATGGGATATGTTTCCA
TTT


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>20193 155 252     6q22.31    chr6:126086197-126086042 BLAT!
ACTGCCAAAATAATTTCCCTTTTATGTTGCATTATAAAGTGGAGTTATTCCTTTTTTCAT
CCTTTCATATATTAAAAGAGTGAGATGGAAGTGGTTTTACGATAATACTGTAGCTGGATT
TACTGTCATCTTTAGTCCAAACTGATCCTAGGCAG


invisible?    
Gene introns: 0  

>20912 128 252     5p15.32    chr5:6151032-6151159 BLAT!
TTCCAGTTTAATGGAATCGTTGTTGTGTCCCCTGGTGGCAGCATTCCTCCCTCTGGCACT
AAGACCTCTAGGACCGCAGAACATAATGTCATGTGAACAGGAAGCAAAAATTTTGATAGT
GGATCACT


invisible?    
Gene introns: 0  

>24867 150 252     4q26    chr4:116091394-116091245 BLAT!
AAGGGGAACACCAAGACTTTGGAATGATTTGGAAGAACAGAGTTAACATTAACTGAGATG
GTGCTATGGTTGAAATGTGTATCGCCACAATTCACGCATTAAAACCATAACCCCCAGTAT
CTCAGAATTCAGTCTTAGATATAGGGTCTT


invisible?    
Gene introns: 0  

Shown 2461-2490 from 3142 sequences on 83 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs