Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2521-2550 from 3142 sequences on 85 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>4088 117 246     15q21.1    chr15:47097883-47097767 BLAT!
AAAATCTTTGCCTGGGCCAGTGTTCAAAAAAGTATTTCCTAGGTTTTGTTCTAGGATTTT
TATAGTTTGAGGTTTTAAATTTAAGTCTTTAATCCATCTTGAGTTAATTTTTGTATA


invisible?    
Gene introns: 0  

>28049 156 246     4p11    chr4:49096541-49096614 BLAT!
TTCCATTCCATTCCAGTCCTTTCCATTCCATTCCACTCGTGTTGATTCCATTCTTTCCAT
TCCATTCAAGTTGAATCCATTCCATTGCATTCCATTCCATTCGATTCCATTCGATTGCAC
TCGGGTTGATTCCATTCCTTTGCATTCCATTCCATT


invisible?    
Gene introns: 0  

>28215 117 246     12q23.2    chr12:102606328-102606212 BLAT!
TAAAAATCAATTGTTGGGGAGCAGGATATAGTGAGGGAAAGGGCTGGCCAAGCAAGGCCT
CACTGAAAAAATGATATTTGAGACAAGACTTGGAGGTTAAGAGGAAGGCCAGGCAGA


invisible?    
Gene introns: 0  

>5953 117 245     1q41    chr1:218109724-218109840 BLAT!
TTCATTTATTGCACAGGTAAGTAAAGAGAAAATACAGATATGCCTACACAGGAAGATAGA
AGTTGGTCAATATCCAAATGTGACACTATCTATGCCATTTTCCTCTGCACATTAAAG


invisible?    
Gene introns: 0  

>9848 141 245     3q28    chr3:188654751-188654891 BLAT!
AGCTGAATAGTCACAAAGCCCTTTCCCATATTTACATATTCTCTACTTCTCATAACAACC
TGAGATTGCTCAGGCAAGAATCAACACTGGGTTTGACTATTGAAACCAAGAAGGCCTGTA
AGCAGCAGAGCGGATTTTGAA


invisible?    
Gene introns: 0  

>10633 132 245     12p11.1    chr12:34439565-34439696 BLAT!
AATGGGAGGTAGAGGCACCTGTGGAAGGAAAAAAAATGGTGCCATAGGGAAGGGGGTCTG
GGTCCTCCCACAGATGAATGTGCCTTCCCAGCAGCCACTGCACGAGGCCCAGGGGATAGT
GGCATCAGTGGT


invisible?    
Gene introns: 0  

>28601 150 245     6p12.3    chr6:47128652-47128801 BLAT!
TTAGCAGAGACACCTGAGTAAGCTTAGCTATTGTGTAAAAGAACAAAGAATCATTTTGAT
TGCATTTGATGGGAACCACCAATGAAAAACCCTTTTAATAAGTATGAACAGAGCTAGATA
CTGAATGGACTATGGAAATTGTGACCTCAA


invisible?    
Gene introns: 0  

>4602 113 244     9q33.1    chr9:122190606-122190718 BLAT!
AGGCTGTGGAGAAATAGGAACACTTTTACATTGTTGGTGAGAATGTAAATTAGTTCAACC
ATTGTGGAAGACAATGTGGTGATTCCTCAAGGATCTAGAACCAGAAATACCAT


invisible?    
Gene introns: 0  

>9608 152 244     11p11.12    chr11:50049431-50049582 BLAT!
CTCTACTCTCTTCCTGGATAGCTTTGGGTCCTCTGTCACTTGTCTGCTTTGGCATCACCC
CCTCCTGGAAGCCTTCCTTGACTCTCCAGATTCTCAGGAGCATGAGAGGTGAGGTGCTCC
TCCCATGAATGGATGGAGATTAGGGAGTATGG


invisible?    
Gene introns: 0  

>13906 137 244     3q22.3    chr3:137139623-137139759 BLAT!
AGCAAGCTTCCTGGAGGTCCAAAAATTCGCCCATCTGATTCCACTAACACTGGAGGCAGT
GTATACTGCCCTGGGGCCCAAGATTAGGCATGCTTAGACCACTGCTACCACCACAGAAGT
CTGAAGACTGACCCACC


invisible?    
Gene introns: 0  

>14115 126 244     14q23.3    chr14:65302786-65302911 BLAT!
GTGAGGCTGTGAGGTCGAATGAGCAGAAATGATGTGCACCACTTCAAGGCCTTAGCCATA
AAATCTTCCCCATAATTCTTACTCTTTGCTCTAAATTCCTAGGACCTAGAGGATGGGGCC
ATAAGG


invisible?    
Gene introns: 0  

>14414 122 244     4p15.1    chr4:28627423-28627302 BLAT!
TGATTTAATTAACTTAATTGATTAATTTTTTATGTTATATTTTATCATGTCAGTTTCATT
CACTAGGTTTAGTGAGAAATTCAGGATCAGTCTAAAATAAGCTGTTTCTTCCCCCACATG
AC


invisible?    
Gene introns: 0  

>18076 117 244     1p34.3    chr1:34971549-34971433 BLAT!
TGGCAATGGAAAAAGTAGAGCATTTCTGTGGGGGAGTAAGAAGACTTCTGAAATACCCAG
AAACACTAAATCAAATTTAAAAATTGCAGGGTGTGGAATTGGGGAATGTAGAGTATT


invisible?    
Gene introns: 0  

>19987 100 244     20q12    chr20:38571689-38571788 BLAT!
CAGAAAGGAAAAAGTGTTTTTCAGACCTTTTGTCCCCATACCAGAAAAGCAAACACTTAG
ATCTAATCTATCAACAAATAACATCAATTTACCTCTTCTT


invisible?    
Gene introns: 0  

>21192 138 244     9p21.3    chr9:24924216-24924353 BLAT!
CAAAAAGAAGGAAAACAAGTTTTTTACCTGTTCTATAGCTGAGCCACACTCCATCTTCTG
CCTTTGCACATTAGAACTTCAGATTCTCTGGCTTTTGGACTCTCAAACTTGCACCAATAT
GCCCTTAGGTTCTCAGGC


invisible?    
Gene introns: 0  

>22613 105 244     13q31.1    chr13:83290732-83290628 BLAT!
TTTGGGAGGCCAAGGCAGGCGGATCACGAGGTCAGGAGAATGAGACCATCCTGGCCAACA
AGGTAAAACTTCATCTCTACTAAAAATACAGAAATTAGCTGGGTG


invisible?    
Gene introns: 0  

>23992 141 244     3p26.1    chr3:4024178-4024039 BLAT!
AGGTTCCATTATCAAAACGAGCAAAATTTGTTGGACCTGGTGGCTATAACTTAAAAAAAC
TTCAGGCTGAAACAGGTGTAACTATTAGTCAGGTGGATGAAGAAACGTTTTCTGTATTTG
CACCAACACCCAGTGCTATGC


invisible?    
Gene introns: 0  

>25689 139 244     17p12    chr17:13584664-13584802 BLAT!
TGGTCTCTTTCTCTCTGAAATCATTTTTTAAATCACATTCTGTCGAAATAATATTAGGAT
TTAACCATCAGACAGAGAATGATTTTGAGAAGAGGTAGTTATATGTCCCCCAAATGAAAT
CTGCCCTTTCTGCTTTTAT


invisible?    
Gene introns: 0  

>18596 132 243     Xp11.3    chrX:44972499-44972368 BLAT!
AGAGATGATTACTTCTAGTAGATAGCCAATATTTACCAAATTATTAACTAATCGAAAAAA
GTATCTCCATGCTTTCAACCTTCAAACTGTTTCTAAGAGGATAACATACTCTAAATCTGA
AAGAGTATGTGA


invisible?    
Gene introns: 0  

>20318 107 243     Xq25    chrX:121906214-121906108 BLAT!
GAGCCATGGTGAAAAAATGAAAGGATATCCACTTTTATCTGAGTGAGCCGTTAATGACCA
TTTGGTTCCTGGTCATTTTCTGTAGTATTAGAAGGTTTGGGGAAAGA


invisible?    
Gene introns: 0  

>25876 138 243     19q13.11    chr19:34416365-34416502 BLAT!
AAGGATTGACCCCAAGGTGGAGGTGGGGCATCCATACAGATGACATCACTATCACTGCAT
GACTGCTTTGCTCAGAGCTGGGAGCTGGGAAAGGGATGCTGCCAAGTCTGGCAATGGAGG
CTGGAGCTTCACAAGGGG


invisible?    
Gene introns: 0  

>26897 138 243     2q31.1    chr2:171660540-171660403 BLAT!
GAATATCTGAACAGAGTCGGGACTGTCTTTGCTCTTTGCAAAGAAAGGGAAAAGGATAGT
TGCTGAGTAGGAAACCAACAGTGCCCACTATATTTGCTTTCCCAATTTTCCTCTTGGTTG
TTCCTTCTCAGTCTATTA


invisible?    
Gene introns: 0  

>30111 139 243     12q14.1    chr12:60562247-60562109 BLAT!
TAAGAAAACCACTGTCTGGACTGGTTCTGGTGCTGGTGGGTTTATAGATATTGCATACTT
GCCTGCCTTTGTGTCCTGAAAAGACATTTTGACCAATAGAACCTAATTGCAATACATTTG
AATGTTAAGTTTCCACCCC


invisible?    
Gene introns: 0  

>4033 129 242     22q12.3    chr22:35898125-35897997 BLAT!
TGCCTGGAACTCGTTAGCAACTGCGAGCAGAAGCTTTCCAGTCACACATCAAGGCGCTTG
ATCACAATGGAAAAGGTGAAGAAATTTGAGAATCGGGACCAGTATTCACATCTGCTAAGT
GATCATTTT


invisible?    
Gene introns: 0  

>7027 157 242     8p21.3    chr8:20878631-20878787 BLAT!
GACTTTTTTTATGCTGATTACATCTTGAAATGATATTCTGAATATATCAAATTAAATAGA
ATGTAATACTATTAATAAAATTAACTTCACCTGTCCCTTTTCACATTTTAAAATGTGGCA
TTTTGAAAATTTAAGAAGAGTAGATTTTAAGTGTTCT


invisible?    
Gene introns: 0  

>16327 133 242     9q21.11    chr9:71300583-71300451 BLAT!
ATAAGTTAAAATTACACTTCTATTGGTATAAGCCATGAAAATTATGCTCTGAGACGTGGC
TACCATTTGTAGATGTGGTCCCTGGACCAGCAGCCTCAGCATCACCTAGAAATTTACTAG
AAATGCGGAGTCT


invisible?    
Gene introns: 0  

>20783 126 242     2q31.3    chr2:181637244-181637369 BLAT!
CAAACGAACAACAACAACAAAAAACCTCTAAGTAATAAGTCTGTAACTTTACACCAAAGG
GGATTTTTCTTCAGTAATTCTATAGGATTTTTGGGTTCTTTACATTAAGTTGAATACAAA
CATAAC


invisible?    
Gene introns: 0  

>29924 118 242     17q22    chr17:52406676-52406559 BLAT!
ATGAGGCTTCTGAACTGATAGCCAAAAGTAAATCATCCACATACTGAAGGACCAGAATGC
CTGGACTTGAGAAGTGGCCTAGATCTTGGGCCAGTGCCTGACCAAAGAGATGAGGGCT


invisible?    
Gene introns: 0  

>11933 140 241     12q24.21    chr12:116190699-116190838 BLAT!
TTTGGGAAAAGGTTTGAGGAAAACTTTTTTAATGTCTTCCATTACCACGGGGCATGTGAA
GGTGTTGTAATTATACCACTAACCAAAGAATTCATTTCTTTCCTGAATCCCTGAAAGAAT
CTGAATAATCTGAGGACGTA


invisible?    
Gene introns: 0  

>13040 140 241     18q12.1    chr18:31898094-31897955 BLAT!
CATTTTTAAACCAGTGCTGGAGGAAATGAAAAATGTGTTTCAAAATTATTTTAGTTTGAT
AAGGAGCCTGGAAGACTGGTCTTTTCCCCAAGGGGTTAAGTCCCTGGGGCAGAGATAATG
ATGTCTATTTGTGTTTCTTA


invisible?    
Gene introns: 0  

Shown 2521-2550 from 3142 sequences on 85 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs